SDF-1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10118-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SDF-1 Reagents
CRO Services
Product recommended

All SDF-1 Reagents
SDF-1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
282 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1), transcript variant 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI (6kb + 0.33kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SDF-1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SDF-1 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
SDF-1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
IRH cDNA ORF Clone, Human;PBSF cDNA ORF Clone, Human;SCYB12 cDNA ORF Clone, Human;SDF-1 cDNA ORF Clone, Human;SDF1 cDNA ORF Clone, Human;TLSF cDNA ORF Clone, Human;TPAR1 cDNA ORF Clone, Human
SDF-1 Background Information

The human stromal cell-derived factor-1 (SDF1), also known as CXCL12, is a small (8 kDa) cytokine highly conserved chemotactic cytokine belonging to the large family of CXC chemokines. SDF1 is expressed in two isoforms from a single gene that encodes two splice variants, SDF1α and SDF1β, which are identical except for the four residues present in the C-terminus of SDF1β but absent from SDF1α. The chemokine CXCL12 [stromal cell-derived factor-1 (SDF-1)] binds primarily to CXC receptor 4 (CXCR4; CD184). The binding of CXCL12 to CXCR4 induces intracellular signaling through several divergent pathways initiating signals related to chemotaxis, cell survival and/or proliferation, increase in intracellular calcium, and gene transcription. CXCL12 and CXCR4 that have been widely characterized in peripheral tissues and delineate their main functions in the CNS. Extensive evidence supports CXCL12 as a key regulator for early development of the CNS. In the mature CNS, CXCL12 modulates neurotransmission, neurotoxicity and neuroglial interactions. CXCL12 has crucial roles in the formation of multiple organ systems during embryogenesis and in the regulation of bone marrow haematopoiesis and immune function in the postnatal organism. Although considered an important factor in normal bone metabolism, recent studies implicate CXCL12 in the pathogenesis of several diseases involving the skeleton, including rheumatoid arthritis and cancers that metastasize to bone. The CXCL12/CXCR4 axis is involved in tumor progression, angiogenesis, metastasis, and survival. Pathologically enhanced CXCL12 signaling may promote the formation of new vessels through recruiting circulating endothelial progenitor cells or directly enhancing the migration/growth of endothelial cells. Therefore, CXCL12 signaling represents an important mechanism that regulates brain tumor angiogenesis/vasculogenesis and may provide potential targets for anti-angiogenic therapy in malignant gliomas.

Full Name
chemokine (C-X-C motif) ligand 12
References
  • Bleul, C.C. et al., 1996, Nature. 382: 829-833.
  • Sapede, D. et al., 2005, Proc. Natl. Acad. Sci. USA. 102: 1714-1718.
  • Delgado, M.B. et al., 2001, Eur. J. Immunol. 31: 699-707.
  • Orimo, A. et al., 2005, Cell. 121: 335-348.
  • Kryczek, I. et al., 2007, Am. J. Physiol. Cell. Physiol. 292: C987-995.
  • Bbalabanian, K. et al., 2005, J. Biol. Chem. 280: 35760-35766.
  • SDF-1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    SDF-1 cDNA ORF Clone in Cloning Vector, Canine DG70055-G
    SDF-1 cDNA ORF Clone, Canine, untagged DG70055-UT
    SDF-1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70055-ACGLN
    SDF-1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70055-ACG
    SDF-1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70055-ACR
    SDF-1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70055-CF
    SDF-1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70055-NF
    SDF-1 cDNA ORF Clone, Canine, C-His tag DG70055-CH
    SDF-1 cDNA ORF Clone, Canine, N-His tag DG70055-NH
    SDF-1 cDNA ORF Clone, Canine, C-HA tag DG70055-CY
    SDF-1 cDNA ORF Clone, Canine, N-HA tag DG70055-NY
    SDF-1 cDNA ORF Clone, Canine, C-Myc tag DG70055-CM
    SDF-1 cDNA ORF Clone, Canine, N-Myc tag DG70055-NM

    SDF-1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    SDF-1 cDNA ORF Clone in Cloning Vector, Rhesus CG90009-M
    SDF-1 cDNA ORF Clone, Rhesus, untagged CG90009-UT
    SDF-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90009-ACGLN
    SDF-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90009-ACG
    SDF-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90009-ACR
    SDF-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90009-CF
    SDF-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90009-NF
    SDF-1 cDNA ORF Clone, Rhesus, C-His tag CG90009-CH
    SDF-1 cDNA ORF Clone, Rhesus, N-His tag CG90009-NH
    SDF-1 cDNA ORF Clone, Rhesus, C-HA tag CG90009-CY
    SDF-1 cDNA ORF Clone, Rhesus, N-HA tag CG90009-NY
    SDF-1 cDNA ORF Clone, Rhesus, C-Myc tag CG90009-CM
    SDF-1 cDNA ORF Clone, Rhesus, N-Myc tag CG90009-NM

    SDF-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SDF-1 cDNA ORF Clone in Cloning Vector, Rat RG81830-U
    SDF-1 cDNA ORF Clone, Rat, untagged RG81830-UT
    SDF-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81830-ACGLN
    SDF-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81830-ACG
    SDF-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81830-ACR
    SDF-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81830-CF
    SDF-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81830-NF
    SDF-1 cDNA ORF Clone, Rat, C-His tag RG81830-CH
    SDF-1 cDNA ORF Clone, Rat, N-His tag RG81830-NH
    SDF-1 cDNA ORF Clone, Rat, C-HA tag RG81830-CY
    SDF-1 cDNA ORF Clone, Rat, N-HA tag RG81830-NY
    SDF-1 cDNA ORF Clone, Rat, C-Myc tag RG81830-CM
    SDF-1 cDNA ORF Clone, Rat, N-Myc tag RG81830-NM

    SDF-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SDF-1 cDNA ORF Clone in Cloning Vector, Mouse MG50025-M
    SDF-1 cDNA ORF Clone, Mouse, untagged MG50025-UT
    SDF-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50025-ACGLN
    SDF-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50025-ACG
    SDF-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50025-ACR
    SDF-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50025-CF
    SDF-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50025-NF
    SDF-1 cDNA ORF Clone, Mouse, C-His tag MG50025-CH
    SDF-1 cDNA ORF Clone, Mouse, N-His tag MG50025-NH
    SDF-1 cDNA ORF Clone, Mouse, C-HA tag MG50025-CY
    SDF-1 cDNA ORF Clone, Mouse, N-HA tag MG50025-NY
    SDF-1 cDNA ORF Clone, Mouse, C-Myc tag MG50025-CM
    SDF-1 cDNA ORF Clone, Mouse, N-Myc tag MG50025-NM
    SDF-1 qPCR Primer Pairs, Mouse MP200025

    SDF-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SDF-1 cDNA ORF Clone in Cloning Vector, Human HG10118-M
    SDF-1 cDNA ORF Clone, Human, untagged HG10118-UT
    SDF-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10118-ACG
    SDF-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10118-ACGLN
    SDF-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10118-ACR
    SDF-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10118-CF
    SDF-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10118-NF
    SDF-1 cDNA ORF Clone, Human, C-His tag HG10118-CH
    SDF-1 cDNA ORF Clone, Human, N-His tag HG10118-NH
    SDF-1 cDNA ORF Clone, Human, C-HA tag HG10118-CY
    SDF-1 cDNA ORF Clone, Human, N-HA tag HG10118-NY
    SDF-1 cDNA ORF Clone, Human, N-Myc tag HG10118-NM
    SDF-1 qPCR Primer Pairs, Human HP100192
    info info
    添加购物车成功! 添加购物车失败!