CXCL11 cDNA ORF Clone, Human, N-His tag

Cat: HG10876-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CXCL11 Reagents
CRO Services
Product recommended

All CXCL11 Reagents
CXCL11 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
285 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 11 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL11 cDNA ORF Clone, Human, N-His tag Alternative Names
b-R1 cDNA ORF Clone, Human;H174 cDNA ORF Clone, Human;I-TAC cDNA ORF Clone, Human;IP-9 cDNA ORF Clone, Human;IP9 cDNA ORF Clone, Human;SCYB11 cDNA ORF Clone, Human;SCYB9B cDNA ORF Clone, Human
CXCL11 Background Information

I-TAC, also known as CXCL11, is a small cytokine belonging to the CXC chemokine family. It is highly expressed in peripheral blood leukocytes, pancreas and liver, with moderate levels in thymus, spleen and lung and low expression levels were in small intestine, placenta and prostate. The I-TAC chemokine elicits its effects on its target cells by interacting with the cell surface chemokine receptor CXCR3, with a higher affinity than do the other ligands for this receptor, CXCL9 and CXCL10. I-TAC is chemotactic for activated T cells. The CXCL11 gene is located on human chromosome 4 along with many other members of the CXC chemokine family.

Full Name
chemokine (C-X-C motif) ligand 11
References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Rani MR, et al. (2002) Requirement of phosphoinositide 3-kinase and Akt for interferon-beta-mediated induction of the beta-R1 (SCYB11) gene. J Biol Chem. 277(41): 38456-61.
  • Salmaggi A, et al. (2003) Expression and modulation of IFN-gamma-inducible chemokines (IP-10, Mig, and I-TAC) in human brain endothelium and astrocytes: possible relevance for the immune invasion of the central nervous system and the pathogenesis of multiple sclerosis. J Interferon Cytokine Res. 22(6):631-40.
  • CXCL11 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CXCL11 cDNA ORF Clone in Cloning Vector, Mouse MG50151-M
    CXCL11 cDNA ORF Clone, Mouse, untagged MG50151-UT
    CXCL11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50151-ACG
    CXCL11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50151-ACGLN
    CXCL11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50151-ACR
    CXCL11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50151-CF
    CXCL11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50151-NF
    CXCL11 cDNA ORF Clone, Mouse, C-His tag MG50151-CH
    CXCL11 cDNA ORF Clone, Mouse, N-His tag MG50151-NH
    CXCL11 cDNA ORF Clone, Mouse, C-HA tag MG50151-CY
    CXCL11 cDNA ORF Clone, Mouse, N-HA tag MG50151-NY
    CXCL11 cDNA ORF Clone, Mouse, C-Myc tag MG50151-CM
    CXCL11 cDNA ORF Clone, Mouse, N-Myc tag MG50151-NM
    CXCL11 qPCR Primer Pairs, Mouse MP200181

    CXCL11 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CXCL11 cDNA ORF Clone in Cloning Vector, Human HG10876-M
    CXCL11 cDNA ORF Clone, Human, untagged HG10876-UT
    CXCL11 cDNA ORF Clone, Human, C-GFPSpark® tag HG10876-ACG
    CXCL11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10876-ACGLN
    CXCL11 cDNA ORF Clone, Human, C-OFPSpark® tag HG10876-ACR
    CXCL11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10876-CF
    CXCL11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10876-NF
    CXCL11 cDNA ORF Clone, Human, C-His tag HG10876-CH
    CXCL11 cDNA ORF Clone, Human, C-HA tag HG10876-CY
    CXCL11 cDNA ORF Clone, Human, N-HA tag HG10876-NY
    CXCL11 cDNA ORF Clone, Human, C-Myc tag HG10876-CM
    CXCL11 cDNA ORF Clone, Human, N-Myc tag HG10876-NM
    CXCL11 qPCR Primer Pairs, Human HP100762
    info info
    添加购物车成功! 添加购物车失败!