IP-10 cDNA ORF Clone, Human, N-His tag

Cat: HG10768-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IP-10 Reagents
CRO Services
Product recommended

All IP-10 Reagents
IP-10 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
297 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 10 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IP-10 cDNA ORF Clone, Human, N-His tag Alternative Names
C7 cDNA ORF Clone, Human;crg-2 cDNA ORF Clone, Human;gIP-10 cDNA ORF Clone, Human;IFI10 cDNA ORF Clone, Human;INP10 cDNA ORF Clone, Human;IP-10 cDNA ORF Clone, Human;mob-1 cDNA ORF Clone, Human;SCYB10 cDNA ORF Clone, Human
IP-10 Background Information

CXCL10, also known as crg-2, is a chemokine of the CXC subfamily and ligand for the receptor CXCR3. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL10 has a three-dimensional crystal structure. Its signaling is mediated by the g protein-coupled receptor CXCR3, which is expressed on activated T cells and plays an important role in directing the migration of T cells, especially during Th1 responses. Binding of CXCL10 to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. It is chemotactic for monocytes and T-lymphocytes. CXCL10 can be secreted by several cell types in response to IFN-γ. Baseline pre-treatment plasma levels of CXCL10 are elevated in patients chronically infected with hepatitis C virus (HCV) of genotypes 1 or 4 who do not achieve a sustained viral response (SVR) after completion of antiviral therapy.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
chemokine (C-X-C motif) ligand 10
References
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Swaminathan GJ, et al. (2003) Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine. Structure. 11(5):521-32.
  • Booth V, et al. (2002) The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions. Biochemistry. 41(33):10418-25.
  • IP-10 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IP-10 cDNA ORF Clone in Cloning Vector, Rat RG80057-M
    IP-10 cDNA ORF Clone in Cloning Vector, Rat RG8A6918-U
    IP-10 cDNA ORF Clone, Rat, untagged RG80057-UT
    IP-10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6918-ACGLN
    IP-10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80057-ACG
    IP-10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80057-ACGLN
    IP-10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80057-ACR
    IP-10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80057-CF
    IP-10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80057-NF
    IP-10 cDNA ORF Clone, Rat, C-His tag RG80057-CH
    IP-10 cDNA ORF Clone, Rat, N-His tag RG80057-NH
    IP-10 cDNA ORF Clone, Rat, C-HA tag RG80057-CY
    IP-10 cDNA ORF Clone, Rat, N-HA tag RG80057-NY
    IP-10 cDNA ORF Clone, Rat, C-Myc tag RG80057-CM
    IP-10 cDNA ORF Clone, Rat, N-Myc tag RG80057-NM
    IP-10 qPCR Primer Pairs, Rat RP300055

    IP-10 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IP-10 cDNA ORF Clone in Cloning Vector, Mouse MG50139-M
    IP-10 cDNA ORF Clone, Mouse, untagged MG50139-UT
    IP-10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50139-ACGLN
    IP-10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50139-ACG
    IP-10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50139-ACR
    IP-10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50139-CF
    IP-10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50139-NF
    IP-10 cDNA ORF Clone, Mouse, C-His tag MG50139-CH
    IP-10 cDNA ORF Clone, Mouse, N-His tag MG50139-NH
    IP-10 cDNA ORF Clone, Mouse, C-HA tag MG50139-CY
    IP-10 cDNA ORF Clone, Mouse, N-HA tag MG50139-NY
    IP-10 cDNA ORF Clone, Mouse, C-Myc tag MG50139-CM
    IP-10 cDNA ORF Clone, Mouse, N-Myc tag MG50139-NM
    IP-10 qPCR Primer Pairs, Mouse MP200169

    IP-10 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IP-10 cDNA ORF Clone in Cloning Vector, Human HG10768-M
    IP-10 cDNA ORF Clone, Human, untagged HG10768-UT
    IP-10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10768-ACGLN
    IP-10 cDNA ORF Clone, Human, C-GFPSpark® tag HG10768-ACG
    IP-10 cDNA ORF Clone, Human, C-OFPSpark® tag HG10768-ACR
    IP-10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10768-CF
    IP-10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10768-NF
    IP-10 cDNA ORF Clone, Human, C-His tag HG10768-CH
    IP-10 cDNA ORF Clone, Human, C-HA tag HG10768-CY
    IP-10 cDNA ORF Clone, Human, N-HA tag HG10768-NY
    IP-10 cDNA ORF Clone, Human, C-Myc tag HG10768-CM
    IP-10 cDNA ORF Clone, Human, N-Myc tag HG10768-NM
    IP-10 qPCR Primer Pairs, Human HP100690
    info info
    添加购物车成功! 添加购物车失败!