CXCL1 cDNA ORF Clone, Human, N-His tag

Cat: HG10877-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CXCL1 Reagents
CRO Services
Product recommended

All CXCL1 Reagents
CXCL1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
324 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL1 cDNA ORF Clone, Human, N-His tag Alternative Names
FSP cDNA ORF Clone, Human;GRO1 cDNA ORF Clone, Human;GROa cDNA ORF Clone, Human;MGSA cDNA ORF Clone, Human;MGSA-a cDNA ORF Clone, Human;NAP-3 cDNA ORF Clone, Human;SCYB1 cDNA ORF Clone, Human
CXCL1 Background Information

The Chemokine (C-X-C motif) Ligand 1, CXCL1, is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GRO?, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-a). CXCL1 already known to be important in osteoarthritis (OA), as a novel target gene of transcription factor AP-2? in chondrocytes and support the important role of AP-2? in cartilage. CXCL1 is a potent neutrophil chemoattractant with recognized roles in angiogenesis and inflammation. CXCL1 is a novel immediate PTH/PTHrP-responsive gene. CXCL1 may act as a chemoattractant for osteoclast precursors. CXCL1 may also have important pro-nociceptive effects via its direct actions on sensory neurons, and may induce long-term changes that involve protein synthesis. CXCL1 plays a critical nonredundant role in the development of experimental Lyme arthritis and carditis via CXCR2-mediated recruitment of neutrophils into the site of infection. CXCL1 functions through CXCR2 to transactivate the EGFR by proteolytic cleavage of HB-EGF, leading to activation of MAPK signalling and increased proliferation of epithelial ovarian cancer (EOC) cells. It might limit tumor growth by reinforcing senescence early in tumorigenesis. Thus, CXCL1 plays a role in spinal cord development by inhibiting the migration of oligodendrocyte precursors and is involved in the processes of angiogenesis, inflammation, wound healing, and tumorigenesis.

Full Name
chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
References
  • Wang JG, et al. (2008) The chemokine CXCL1/growth related oncogene increases sodium currents and neuronal excitability in small diameter sensory neurons. Mol Pain. 4: 38.
  • Acosta JC, et al. (2009) A role for CXCR2 in senescence, but what about in cancer? Cancer Res. 69(6): 2167-70.
  • Onan D, et al. (2009) The chemokine Cxcl1 is a novel target gene of parathyroid hormone (PTH)/PTH-related protein in committed osteoblasts. Endocrinology. 150(5): 2244-53.
  • Ritzman AM, et al. (2010) The chemokine receptor CXCR2 ligand KC (CXCL1) mediates neutrophil recruitment and is critical for development of experimental Lyme arthritis and carditis. Infect Immun. 78(11): 4593-600.
  • Bolitho C, et al. (2010) The chemokine CXCL1 induces proliferation in epithelial ovarian cancer cells by transactivation of the epidermal growth factor receptor. Endocr Relat Cancer. 17(4): 929-40.
  • Wenke AK, et al. (2011) The transcription factor AP-2? regulates CXCL1 during cartilage development and in osteoarthritis. Osteoarthritis Cartilage. 19(2): 206-12.
  • CXCL1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CXCL1 cDNA ORF Clone in Cloning Vector, Rat RG80039-M
    CXCL1 cDNA ORF Clone, Rat, untagged RG80039-UT
    CXCL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80039-ACGLN
    CXCL1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80039-ACG
    CXCL1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80039-ACR
    CXCL1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80039-CF
    CXCL1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80039-NF
    CXCL1 cDNA ORF Clone, Rat, C-His tag RG80039-CH
    CXCL1 cDNA ORF Clone, Rat, N-His tag RG80039-NH
    CXCL1 cDNA ORF Clone, Rat, C-HA tag RG80039-CY
    CXCL1 cDNA ORF Clone, Rat, N-HA tag RG80039-NY
    CXCL1 cDNA ORF Clone, Rat, C-Myc tag RG80039-CM
    CXCL1 cDNA ORF Clone, Rat, N-Myc tag RG80039-NM
    CXCL1 qPCR Primer Pairs, Rat RP300038

    CXCL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CXCL1 cDNA ORF Clone in Cloning Vector, Mouse MG50150-M
    CXCL1 cDNA ORF Clone, Mouse, untagged MG50150-UT
    CXCL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50150-ACGLN
    CXCL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50150-ACG
    CXCL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50150-ACR
    CXCL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50150-CF
    CXCL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50150-NF
    CXCL1 cDNA ORF Clone, Mouse, C-His tag MG50150-CH
    CXCL1 cDNA ORF Clone, Mouse, N-His tag MG50150-NH
    CXCL1 cDNA ORF Clone, Mouse, C-HA tag MG50150-CY
    CXCL1 cDNA ORF Clone, Mouse, N-HA tag MG50150-NY
    CXCL1 cDNA ORF Clone, Mouse, C-Myc tag MG50150-CM
    CXCL1 cDNA ORF Clone, Mouse, N-Myc tag MG50150-NM
    CXCL1 qPCR Primer Pairs, Mouse MP200180

    CXCL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CXCL1 cDNA ORF Clone in Cloning Vector, Human HG10877-M
    CXCL1 cDNA ORF Clone, Human, untagged HG10877-UT
    CXCL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10877-ACG
    CXCL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10877-ACGLN
    CXCL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10877-ACR
    CXCL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10877-CF
    CXCL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10877-NF
    CXCL1 cDNA ORF Clone, Human, C-His tag HG10877-CH
    CXCL1 cDNA ORF Clone, Human, C-HA tag HG10877-CY
    CXCL1 cDNA ORF Clone, Human, N-HA tag HG10877-NY
    CXCL1 cDNA ORF Clone, Human, C-Myc tag HG10877-CM
    CXCL1 cDNA ORF Clone, Human, N-Myc tag HG10877-NM
    CXCL1 qPCR Primer Pairs, Human HP100763
    info info
    添加购物车成功! 添加购物车失败!