Fractalkine cDNA ORF Clone, Human, C-Myc tag

Cat: HG10636-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Fractalkine Reagents
CRO Services
Product recommended

All Fractalkine Reagents
Fractalkine cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Description
Full length Clone DNA of Human chemokine (C-X3-C motif) ligand 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fractalkine cDNA ORF Clone, Human, C-Myc tag Alternative Names
ABCD-3 cDNA ORF Clone, Human;C3Xkine cDNA ORF Clone, Human;CXC3 cDNA ORF Clone, Human;CXC3C cDNA ORF Clone, Human;fractalkine cDNA ORF Clone, Human;neurotactin cDNA ORF Clone, Human;NTN cDNA ORF Clone, Human;NTT cDNA ORF Clone, Human;SCYD1 cDNA ORF Clone, Human
Fractalkine Background Information

Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine / CX3CL1 is a unique chemokine that functions not only as a chemoattractant but also as an adhesion molecule and is expressed on endothelial cells activated by proinflammatory cytokines, such as interferon-gamma and tumor necrosis factor-alpha. Fractalkine/CX3CL1 is expressed in a membrane-bound form on activated endothelial cells and mediates attachment and firm adhesion of T cells, monocytes and NK cells. Fractalkine / CX3CL1 is associated with dendritic cells (DC) in epidermis and lymphoid organs. The fractalkine receptor, CX3CR1, is expressed on cytotoxic effector lymphocytes, including natural killer (NK) cells and cytotoxic T lymphocytes, which contain high levels of intracellular perforin and granzyme B, and on macrophages. Soluble fractalkine causes migration of NK cells, cytotoxic T lymphocytes, and macrophages, whereas the membrane-bound form captures and enhances the subsequent migration of these cells in response to secondary stimulation with other chemokines.

Full Name
chemokine (C-X3-C motif) ligand 1
References
  • Imai T, et al. (1997) Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell. 91(4): 521-30.
  • Papadopoulos EJ, et al. (1999) Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol. 29 (8): 2551-9.
  • Umehara H, et al. (2004) Fractalkine in vascular biology: from basic research to clinical disease". Arterioscler. Thromb Vasc Biol. 24 (1): 34-40.
  • Fractalkine cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Fractalkine cDNA ORF Clone in Cloning Vector, Canine DG70071-G
    Fractalkine cDNA ORF Clone, Canine, untagged DG70071-UT
    Fractalkine cDNA ORF Clone, Canine, C-GFPSpark® tag DG70071-ACG
    Fractalkine Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70071-ACGLN
    Fractalkine cDNA ORF Clone, Canine, C-OFPSpark® tag DG70071-ACR
    Fractalkine cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70071-CF
    Fractalkine cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70071-NF
    Fractalkine cDNA ORF Clone, Canine, C-His tag DG70071-CH
    Fractalkine cDNA ORF Clone, Canine, N-His tag DG70071-NH
    Fractalkine cDNA ORF Clone, Canine, C-HA tag DG70071-CY
    Fractalkine cDNA ORF Clone, Canine, N-HA tag DG70071-NY
    Fractalkine cDNA ORF Clone, Canine, C-Myc tag DG70071-CM
    Fractalkine cDNA ORF Clone, Canine, N-Myc tag DG70071-NM

    Fractalkine cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Fractalkine cDNA ORF Clone in Cloning Vector, Rat RG80163-G
    Fractalkine cDNA ORF Clone, Rat, untagged RG80163-UT
    Fractalkine Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80163-ACGLN
    Fractalkine cDNA ORF Clone, Rat, C-GFPSpark® tag RG80163-ACG
    Fractalkine cDNA ORF Clone, Rat, C-OFPSpark® tag RG80163-ACR
    Fractalkine cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80163-CF
    Fractalkine cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80163-NF
    Fractalkine cDNA ORF Clone, Rat, C-His tag RG80163-CH
    Fractalkine cDNA ORF Clone, Rat, N-His tag RG80163-NH
    Fractalkine cDNA ORF Clone, Rat, C-HA tag RG80163-CY
    Fractalkine cDNA ORF Clone, Rat, N-HA tag RG80163-NY
    Fractalkine cDNA ORF Clone, Rat, C-Myc tag RG80163-CM
    Fractalkine cDNA ORF Clone, Rat, N-Myc tag RG80163-NM
    Fractalkine qPCR Primer Pairs, Rat RP300157

    Fractalkine cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Fractalkine cDNA ORF Clone in Cloning Vector, Mouse MG50917-G
    Fractalkine cDNA ORF Clone, Mouse, untagged MG50917-UT
    Fractalkine Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50917-ACGLN
    Fractalkine cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50917-ACG
    Fractalkine cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50917-ACR
    Fractalkine cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50917-CF
    Fractalkine cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50917-NF
    Fractalkine cDNA ORF Clone, Mouse, C-His tag MG50917-CH
    Fractalkine cDNA ORF Clone, Mouse, N-His tag MG50917-NH
    Fractalkine cDNA ORF Clone, Mouse, C-HA tag MG50917-CY
    Fractalkine cDNA ORF Clone, Mouse, N-HA tag MG50917-NY
    Fractalkine cDNA ORF Clone, Mouse, C-Myc tag MG50917-CM
    Fractalkine cDNA ORF Clone, Mouse, N-Myc tag MG50917-NM
    Fractalkine qPCR Primer Pairs, Mouse MP200886

    Fractalkine cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Fractalkine cDNA ORF Clone in Cloning Vector, Human HG10636-M
    Fractalkine cDNA ORF Clone, Human, untagged HG10636-UT
    Fractalkine Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10636-ACGLN
    Fractalkine cDNA ORF Clone, Human, C-GFPSpark® tag HG10636-ACG
    Fractalkine cDNA ORF Clone, Human, C-OFPSpark® tag HG10636-ACR
    Fractalkine cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10636-CF
    Fractalkine cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10636-NF
    Fractalkine cDNA ORF Clone, Human, C-His tag HG10636-CH
    Fractalkine cDNA ORF Clone, Human, N-His tag HG10636-NH
    Fractalkine cDNA ORF Clone, Human, C-HA tag HG10636-CY
    Fractalkine cDNA ORF Clone, Human, N-HA tag HG10636-NY
    Fractalkine cDNA ORF Clone, Human, N-Myc tag HG10636-NM
    Fractalkine qPCR Primer Pairs, Human HP100027
    info info
    添加购物车成功! 添加购物车失败!