CUTC cDNA ORF Clone, Human, N-Myc tag

Cat: HG11470-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CUTC Reagents
CRO Services
Product recommended

All CUTC Reagents
CUTC cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
822 bp
Description
Full length Clone DNA of Human cutC copper transporter homolog (E. coli) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CUTC cDNA ORF Clone, Human, N-Myc tag Alternative Names
CGI-32 cDNA ORF Clone, Human
CUTC Background Information

Copper homeostasis protein cutC homolog, also known as CGI-32 and CUTC, is a cytoplasm and nucleus protein which belongs to the CutC family. CUTC may play a role in copper homeostasis. It can bind one Cu1+ per subunit. Copper is an essential trace element to life and particularly plays a pivotal role in the physiology of aerobic organisms. Copper is a micronutrient that is required for proper metabolic functioning of most prokaryotic and eukaryotic organisms. To sustain an adequate supply of copper, a cell requires molecular mechanisms that control the metal content to avoid copper toxicity. This toxicity comes primarily from the reactivity of copper, which can lead to the generation of free radicals. In bacteria, two independent systems are responsible for maintaining the balance of copper within the cells ( Cop and Cut family proteins ). The Cut protein family is associated with copper homeostasis and involved in uptake, storage, delivery, and efflux of copper. CutC is a member of the Cut family and is suggested to be involved in efflux trafficking of cuprous ion. CutC is able to respond transcriptionally to copper and to participate in the control of copper homeostasis in E. faecalis.

Full Name
cutC copper transporter
References
  • Lai C.-H., et al., 2000, Genome Res.10:703-713.
  • Li J., et al., 2005, Biochem. Biophys. Res. Commun. 337:179-183.
  • Li,Y. et al., 2010, J Struct Biol. 169 (3):399-405.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • CUTC cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CUTC cDNA ORF Clone in Cloning Vector, Rat RG8A2751-U
    CUTC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A2751-ACGLN

    CUTC cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CUTC cDNA ORF Clone in Cloning Vector, Mouse MG53112-G
    CUTC cDNA ORF Clone, Mouse, untagged MG53112-UT
    CUTC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53112-ACG
    CUTC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53112-ACGLN
    CUTC cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53112-ANG
    CUTC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53112-ACR
    CUTC cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53112-ANR
    CUTC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53112-CF
    CUTC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53112-NF
    CUTC cDNA ORF Clone, Mouse, C-His tag MG53112-CH
    CUTC cDNA ORF Clone, Mouse, N-His tag MG53112-NH
    CUTC cDNA ORF Clone, Mouse, C-HA tag MG53112-CY
    CUTC cDNA ORF Clone, Mouse, N-HA tag MG53112-NY
    CUTC cDNA ORF Clone, Mouse, C-Myc tag MG53112-CM
    CUTC cDNA ORF Clone, Mouse, N-Myc tag MG53112-NM

    CUTC cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CUTC cDNA ORF Clone in Cloning Vector, Human HG11470-M
    CUTC cDNA ORF Clone, Human, untagged HG11470-UT
    CUTC cDNA ORF Clone, Human, C-GFPSpark® tag HG11470-ACG
    CUTC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11470-ACGLN
    CUTC cDNA ORF Clone, Human, N-GFPSpark® tag HG11470-ANG
    CUTC cDNA ORF Clone, Human, C-OFPSpark® tag HG11470-ACR
    CUTC cDNA ORF Clone, Human, N-OFPSpark® tag HG11470-ANR
    CUTC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11470-CF
    CUTC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11470-NF
    CUTC cDNA ORF Clone, Human, C-His tag HG11470-CH
    CUTC cDNA ORF Clone, Human, N-His tag HG11470-NH
    CUTC cDNA ORF Clone, Human, C-HA tag HG11470-CY
    CUTC cDNA ORF Clone, Human, N-HA tag HG11470-NY
    CUTC cDNA ORF Clone, Human, C-Myc tag HG11470-CM
    CUTC qPCR Primer Pairs, Human HP101347
    info info
    添加购物车成功! 添加购物车失败!