Cathepsin Z cDNA ORF Clone, Human, N-His tag

Cat: HG10159-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cathepsin Z Reagents
CRO Services
Product recommended

All Cathepsin Z Reagents
Cathepsin Z cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
912 bp
Description
Full length Clone DNA of Human cathepsin Z with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cathepsin Z cDNA ORF Clone, Human, N-His tag Alternative Names
CTSX cDNA ORF Clone, Human
Cathepsin Z Background Information

Cathepsin Z (CTSZ), also known as Cathepsin X or CATX, belongs to the C1 family of lysosomal cysteine proteases. Its gene structure and activity properties show several unique features that distinguish it clearly from other human cysteine proteases. It has a very short pro-region that shows no similarity to those of other cathepsins and a three-residue insertion motif that forms a characteristic ‘mini loop’. Cathepsin Z exhibits mono- and di-peptidase activity at its C-terminus, and in contrast to cathepsin B, it does not act as an endopeptidase. It is restricted to the cells of theimmune system, predominantly monocytes, macrophages and dendritic cells. Cathepsin Z is widely expressed in human tissues, suggesting that this enzyme could be involved in the normal intracellular protein degradation taking place in all cell types. It is capable to cleave regulatory motifs at C-terminus affecting the function of targeted molecules. Cathepsin X may regulate also the maturation of dendritic cells, a process, which is crucial in the initiation of adaptive immunity. Furthermore, higher levels of Cathepsin Z are also found in tumour and immune cells of prostate and gastric carcinomas and inmacrophages of gastric mucosa, especially after infection by Helicobacter pylori. Cathepsin Z is also ubiquitously distributed in cancer cell lines and in primary tumors from different sources, suggesting that this enzyme may participate in tumor progression.

Full Name
cathepsin Z
References
  • Santamara I, et al. (1998) Cathepsin Z, a novel human cysteine proteinase with a short propeptide domain and a unique chromosomal location. J Biol Chem. 273(27): 16816-23.
  • Kos J, et al. (2009) The role of cathepsin X in cell signaling. Cell Adh Migr. 3(2): 164-6.
  • Sevenich L, et al. (2010) Synergistic antitumor effects of combined cathepsin B and cathepsin Z deficiencies on breast cancer progression and metastasis in mice. Proc Natl Acad Sci U S A. 107(6): 2497-502.
  • Cathepsin Z cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cathepsin Z cDNA ORF Clone in Cloning Vector, Rat RG85651-U
    Cathepsin Z Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85651-ACGLN

    Cathepsin Z cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cathepsin Z cDNA ORF Clone in Cloning Vector, Mouse MG50089-M
    Cathepsin Z cDNA ORF Clone, Mouse, untagged MG50089-UT
    Cathepsin Z Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50089-ACGLN
    Cathepsin Z cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50089-ACG
    Cathepsin Z cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50089-ACR
    Cathepsin Z cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50089-CF
    Cathepsin Z cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50089-NF
    Cathepsin Z cDNA ORF Clone, Mouse, C-His tag MG50089-CH
    Cathepsin Z cDNA ORF Clone, Mouse, N-His tag MG50089-NH
    Cathepsin Z cDNA ORF Clone, Mouse, C-HA tag MG50089-CY
    Cathepsin Z cDNA ORF Clone, Mouse, N-HA tag MG50089-NY
    Cathepsin Z cDNA ORF Clone, Mouse, C-Myc tag MG50089-CM
    Cathepsin Z cDNA ORF Clone, Mouse, N-Myc tag MG50089-NM
    Cathepsin Z qPCR Primer Pairs, Mouse MP200119

    Cathepsin Z cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cathepsin Z cDNA ORF Clone in Cloning Vector, Human HG10159-M
    Cathepsin Z cDNA ORF Clone, Human, untagged HG10159-UT
    Cathepsin Z Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10159-ACGLN
    Cathepsin Z cDNA ORF Clone, Human, C-GFPSpark® tag HG10159-ACG
    Cathepsin Z cDNA ORF Clone, Human, C-OFPSpark® tag HG10159-ACR
    Cathepsin Z cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10159-CF
    Cathepsin Z cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10159-NF
    Cathepsin Z cDNA ORF Clone, Human, C-His tag HG10159-CH
    Cathepsin Z cDNA ORF Clone, Human, C-HA tag HG10159-CY
    Cathepsin Z cDNA ORF Clone, Human, N-HA tag HG10159-NY
    Cathepsin Z cDNA ORF Clone, Human, C-Myc tag HG10159-CM
    Cathepsin Z cDNA ORF Clone, Human, N-Myc tag HG10159-NM
    Cathepsin Z qPCR Primer Pairs, Human HP100229
    info info
    添加购物车成功! 添加购物车失败!