Cathepsin K cDNA ORF Clone, Human, untagged

Cat: HG10796-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cathepsin K Reagents
CRO Services
Product recommended

All Cathepsin K Reagents
Cathepsin K cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
990 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cathepsin K.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 0.99kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Cathepsin K cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cathepsin K cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
Cathepsin K cDNA ORF Clone, Human, untagged Alternative Names
CTS02 cDNA ORF Clone, Human;CTSO cDNA ORF Clone, Human;CTSO1 cDNA ORF Clone, Human;CTSO2 cDNA ORF Clone, Human;PKND cDNA ORF Clone, Human;PYCD cDNA ORF Clone, Human
Cathepsin K Background Information
Full Name
cathepsin K

Cathepsin K cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cathepsin K cDNA ORF Clone in Cloning Vector, Mouse MG50615-M
Cathepsin K cDNA ORF Clone, Mouse, untagged MG50615-UT
Cathepsin K Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50615-ACGLN
Cathepsin K cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50615-ACG
Cathepsin K cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50615-ACR
Cathepsin K cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50615-CF
Cathepsin K cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50615-NF
Cathepsin K cDNA ORF Clone, Mouse, C-His tag MG50615-CH
Cathepsin K cDNA ORF Clone, Mouse, N-His tag MG50615-NH
Cathepsin K cDNA ORF Clone, Mouse, C-HA tag MG50615-CY
Cathepsin K cDNA ORF Clone, Mouse, N-HA tag MG50615-NY
Cathepsin K cDNA ORF Clone, Mouse, C-Myc tag MG50615-CM
Cathepsin K cDNA ORF Clone, Mouse, N-Myc tag MG50615-NM
Cathepsin K qPCR Primer Pairs, Mouse MP200600

Cathepsin K cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cathepsin K cDNA ORF Clone in Cloning Vector, Human HG10796-M
Cathepsin K cDNA ORF Clone, Human, C-GFPSpark® tag HG10796-ACG
Cathepsin K Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10796-ACGLN
Cathepsin K cDNA ORF Clone, Human, C-OFPSpark® tag HG10796-ACR
Cathepsin K cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10796-CF
Cathepsin K cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10796-NF
Cathepsin K cDNA ORF Clone, Human, C-His tag HG10796-CH
Cathepsin K cDNA ORF Clone, Human, N-His tag HG10796-NH
Cathepsin K cDNA ORF Clone, Human, C-HA tag HG10796-CY
Cathepsin K cDNA ORF Clone, Human, N-HA tag HG10796-NY
Cathepsin K cDNA ORF Clone, Human, C-Myc tag HG10796-CM
Cathepsin K cDNA ORF Clone, Human, N-Myc tag HG10796-NM
Cathepsin K qPCR Primer Pairs, Human HP100710
info info
添加购物车成功! 添加购物车失败!