Cathepsin K cDNA ORF Clone, Human, N-His tag

Cat: HG10796-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cathepsin K Reagents
CRO Services
Product recommended

All Cathepsin K Reagents
Cathepsin K cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
990 bp
Description
Full length Clone DNA of Human cathepsin K with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cathepsin K cDNA ORF Clone, Human, N-His tag Alternative Names
CTS02 cDNA ORF Clone, Human;CTSO cDNA ORF Clone, Human;CTSO1 cDNA ORF Clone, Human;CTSO2 cDNA ORF Clone, Human;PKND cDNA ORF Clone, Human;PYCD cDNA ORF Clone, Human
Cathepsin K Background Information
Full Name
cathepsin K

Cathepsin K cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cathepsin K cDNA ORF Clone in Cloning Vector, Mouse MG50615-M
Cathepsin K cDNA ORF Clone, Mouse, untagged MG50615-UT
Cathepsin K Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50615-ACGLN
Cathepsin K cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50615-ACG
Cathepsin K cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50615-ACR
Cathepsin K cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50615-CF
Cathepsin K cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50615-NF
Cathepsin K cDNA ORF Clone, Mouse, C-His tag MG50615-CH
Cathepsin K cDNA ORF Clone, Mouse, N-His tag MG50615-NH
Cathepsin K cDNA ORF Clone, Mouse, C-HA tag MG50615-CY
Cathepsin K cDNA ORF Clone, Mouse, N-HA tag MG50615-NY
Cathepsin K cDNA ORF Clone, Mouse, C-Myc tag MG50615-CM
Cathepsin K cDNA ORF Clone, Mouse, N-Myc tag MG50615-NM
Cathepsin K qPCR Primer Pairs, Mouse MP200600

Cathepsin K cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cathepsin K cDNA ORF Clone in Cloning Vector, Human HG10796-M
Cathepsin K cDNA ORF Clone, Human, untagged HG10796-UT
Cathepsin K cDNA ORF Clone, Human, C-GFPSpark® tag HG10796-ACG
Cathepsin K Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10796-ACGLN
Cathepsin K cDNA ORF Clone, Human, C-OFPSpark® tag HG10796-ACR
Cathepsin K cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10796-CF
Cathepsin K cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10796-NF
Cathepsin K cDNA ORF Clone, Human, C-His tag HG10796-CH
Cathepsin K cDNA ORF Clone, Human, C-HA tag HG10796-CY
Cathepsin K cDNA ORF Clone, Human, N-HA tag HG10796-NY
Cathepsin K cDNA ORF Clone, Human, C-Myc tag HG10796-CM
Cathepsin K cDNA ORF Clone, Human, N-Myc tag HG10796-NM
Cathepsin K qPCR Primer Pairs, Human HP100710
info info
添加购物车成功! 添加购物车失败!