Cathepsin C cDNA ORF Clone, Human, C-His tag

Cat: HG10484-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cathepsin C Reagents
CRO Services
Product recommended

All Cathepsin C Reagents
Cathepsin C cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1437 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cathepsin C with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+1.44kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Cathepsin C cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cathepsin C cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
Cathepsin C cDNA ORF Clone, Human, C-His tag Alternative Names
CPPI cDNA ORF Clone, Human;DPP-I cDNA ORF Clone, Human;DPP1 cDNA ORF Clone, Human;DPPI cDNA ORF Clone, Human;HMS cDNA ORF Clone, Human;JP cDNA ORF Clone, Human;JPD cDNA ORF Clone, Human;PALS cDNA ORF Clone, Human;PDON1 cDNA ORF Clone, Human;PLS cDNA ORF Clone, Human
Cathepsin C Background Information

Cathepsins are proteases found in many types of cells conserved in all animals, which have a vital role in mammalian cellular turnover such as bone resorption. The lysosomal cysteine protease Cathepsin C (CTSC), also known as dipeptidyl peptidase I (DPPI/DPP1), activates a number of granule-associated serine proteases with pro-inflammatory and immune functions by removal of their inhibitory N-terminal dipeptides. This lysosomal exo-cysteine protease belonging to the peptidase C1 family. Active cathepsin C is found in lysosomes as a 200-kDa multimeric enzyme. Subunits constituting this assembly all arise from the proteolytic cleavage of a single precursor giving rise to three peptides: the propeptide, the alpha- and the beta-chains. It is a central coordinator for activation of many serine proteases in immune/inflammatory cells. Defects in the Cathepsin C have been shown to be a cause of Papillon-Lefevre disease, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. Cathepsin C plays a key role in the activation of several degradative enzymes linked to tissue destruction in inflammatory diseases. Thus, it is a therapeutic target for the treatment of a number of inflammatory and autoimmune diseases.

Full Name
cathepsin C
References
  • Santilman V, et al. (2002) Importance of the propeptide in the biosynthetic maturation of rat cathepsin C. Eur J Cell Biol. 81(12): 654-63.
  • Kam CM, et al. (2004) Design and evaluation of inhibitors for dipeptidyl peptidase I (Cathepsin C). Arch Biochem Biophys. 427(2): 123-34.
  • Noack B, et al. (2008) Cathepsin C gene variants in aggressive periodontitis. J Dent Res. 87(10): 958-63.
  • Laine DI, et al. (2010) Inhibitors of cathepsin C (dipeptidyl peptidase I). Expert Opin Ther Pat. 20(4): 497-506.
  • Cathepsin C cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cathepsin C cDNA ORF Clone in Cloning Vector, Rat RG82338-U
    Cathepsin C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82338-ACGLN

    Cathepsin C cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cathepsin C cDNA ORF Clone in Cloning Vector, Mouse MG50007-M
    Cathepsin C cDNA ORF Clone, Mouse, untagged MG50007-UT
    Cathepsin C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50007-ACG
    Cathepsin C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50007-ACGLN
    Cathepsin C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50007-ACR
    Cathepsin C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50007-CF
    Cathepsin C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50007-NF
    Cathepsin C cDNA ORF Clone, Mouse, C-His tag MG50007-CH
    Cathepsin C cDNA ORF Clone, Mouse, N-His tag MG50007-NH
    Cathepsin C cDNA ORF Clone, Mouse, C-HA tag MG50007-CY
    Cathepsin C cDNA ORF Clone, Mouse, N-HA tag MG50007-NY
    Cathepsin C cDNA ORF Clone, Mouse, C-Myc tag MG50007-CM
    Cathepsin C cDNA ORF Clone, Mouse, N-Myc tag MG50007-NM
    Cathepsin C qPCR Primer Pairs, Mouse MP200007

    Cathepsin C cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cathepsin C cDNA ORF Clone in Cloning Vector, Human HG10484-G
    Cathepsin C cDNA ORF Clone, Human, untagged HG10484-UT
    Cathepsin C cDNA ORF Clone, Human, C-GFPSpark® tag HG10484-ACG
    Cathepsin C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10484-ACGLN
    Cathepsin C cDNA ORF Clone, Human, C-OFPSpark® tag HG10484-ACR
    Cathepsin C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10484-CF
    Cathepsin C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10484-NF
    Cathepsin C cDNA ORF Clone, Human, N-His tag HG10484-NH
    Cathepsin C cDNA ORF Clone, Human, C-HA tag HG10484-CY
    Cathepsin C cDNA ORF Clone, Human, N-HA tag HG10484-NY
    Cathepsin C cDNA ORF Clone, Human, C-Myc tag HG10484-CM
    Cathepsin C cDNA ORF Clone, Human, N-Myc tag HG10484-NM
    Cathepsin C qPCR Primer Pairs, Human HP100506
    info info
    添加购物车成功! 添加购物车失败!