Quick Order

Human beta-Catenin/CTNNB1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CTNNB1 cDNA Clone Product Information
NCBI RefSeq:NM_001098209.1
RefSeq ORF Size:2346bp
cDNA Description:Full length Clone DNA of Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa.
Gene Synonym:CTNNB, FLJ25606, FLJ37923, DKFZp686D02253, CTNNB1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CTNNB1
Restriction Site:KpnI + XbaI (6.1kb + 2.35kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CTNNB1 Gene Plasmid Map
Human CTNNB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

beta-Catenin, also known as CTNNB1, is a member of the armadillo family of proteins. These proteins have multiple copies of the so-called armadillo repeat domain, which is specialized for protein-protein binding. It is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. CTNNB1 also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, beta-Catenin binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Defects in beta-Catenin can cause colorectal cancer, pilomatrixoma (PTR), medulloblastoma, and ovarian cancer. CTNNB1 is a key dowstream component of the canonical Wnt signaling pathway. In the absence of Wnt, it forms a complex with AXIN1, AXIN2, APC, CSNK1A1 and GSK3B that promotes phosphorylation on N-terminal Ser and Thr residues and ubiquitination of CTNNB1 via BTRC and its subsequent degradation by the proteasome. In the presence of Wnt ligand, beta-Catenin is not ubiquitinated and accumulates in the nucleus, where it acts as a coactivator for transcription factors of the TCF/LEF family, leading to activate Wnt responsive genes. CTNNB1 is involved in the regulation of cell adhesion. The majority of beta-catenin is localized to the cell membrane and is part of E-cadherin/catenin adhesion complexes which are proposed to couple cadherins to the actin cytoskeleton.

References
  • Yang, et al. (2002) Linking β-catenin to androgen-signaling pathway. J Biol Chem. 277(13):11336-44.
  • Hino S, et al. (2005) Phosphorylation of β-Catenin by Cyclic AMP-Dependent Protein Kinase Stabilizes β-Catenin through Inhibition of Its Ubiquitination. Mol Cell Biol. 25(20):9063-72.
  • Liu X, et al. (2005) Rapid, Wnt-induced changes in GSK3beta associations that regulate beta-catenin stabilization are mediated by Galpha proteins. Curr Biol. 15(22):1989-97.
  • Kraus C, et al. (1994) Localization of the human β-catenin gene (CTNNB1) to 3p21: a region implicated in tumor development. Genomics. 23(1):272-4.
  • Size / Price
    Catalog: HG11279-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human CTNNB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"