Cystathionase/CTH cDNA ORF Clone, Human, C-Myc tag

Cat: HG14190-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cystathionase/CTH Reagents
CRO Services
Product recommended

All Cystathionase/CTH Reagents
Cystathionase/CTH cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1218 bp
Description
Full length Clone DNA of Human cystathionase (cystathionine gamma-lyase) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cystathionase/CTH Background Information
Full Name
cystathionine gamma-lyase

Cystathionase/CTH cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cystathionase/CTH cDNA ORF Clone in Cloning Vector, Rat RG81008-U
Cystathionase/CTH cDNA ORF Clone, Rat, untagged RG81008-UT
Cystathionase/CTH Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81008-ACGLN
Cystathionase/CTH cDNA ORF Clone, Rat, C-GFPSpark® tag RG81008-ACG
Cystathionase/CTH cDNA ORF Clone, Rat, N-GFPSpark® tag RG81008-ANG
Cystathionase/CTH cDNA ORF Clone, Rat, C-OFPSpark® tag RG81008-ACR
Cystathionase/CTH cDNA ORF Clone, Rat, N-OFPSpark® tag RG81008-ANR
Cystathionase/CTH cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81008-CF
Cystathionase/CTH cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81008-NF
Cystathionase/CTH cDNA ORF Clone, Rat, C-His tag RG81008-CH
Cystathionase/CTH cDNA ORF Clone, Rat, N-His tag RG81008-NH
Cystathionase/CTH cDNA ORF Clone, Rat, C-HA tag RG81008-CY
Cystathionase/CTH cDNA ORF Clone, Rat, N-HA tag RG81008-NY
Cystathionase/CTH cDNA ORF Clone, Rat, C-Myc tag RG81008-CM
Cystathionase/CTH cDNA ORF Clone, Rat, N-Myc tag RG81008-NM
Cystathionase/CTH qPCR Primer Pairs, Rat RP300972

Cystathionase/CTH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cystathionase/CTH cDNA ORF Clone in Cloning Vector, Mouse MG51570-G
Cystathionase/CTH cDNA ORF Clone, Mouse, untagged MG51570-UT
Cystathionase/CTH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51570-ACG
Cystathionase/CTH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51570-ACGLN
Cystathionase/CTH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51570-ANG
Cystathionase/CTH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51570-ACR
Cystathionase/CTH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51570-ANR
Cystathionase/CTH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51570-CF
Cystathionase/CTH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51570-NF
Cystathionase/CTH cDNA ORF Clone, Mouse, C-His tag MG51570-CH
Cystathionase/CTH cDNA ORF Clone, Mouse, N-His tag MG51570-NH
Cystathionase/CTH cDNA ORF Clone, Mouse, C-HA tag MG51570-CY
Cystathionase/CTH cDNA ORF Clone, Mouse, N-HA tag MG51570-NY
Cystathionase/CTH cDNA ORF Clone, Mouse, C-Myc tag MG51570-CM
Cystathionase/CTH cDNA ORF Clone, Mouse, N-Myc tag MG51570-NM
Cystathionase/CTH qPCR Primer Pairs, Mouse MP201453

Cystathionase/CTH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cystathionase/CTH cDNA ORF Clone in Cloning Vector, Human HG14190-G
Cystathionase/CTH cDNA ORF Clone, Human, untagged HG14190-UT
Cystathionase/CTH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14190-ACGLN
Cystathionase/CTH cDNA ORF Clone, Human, C-GFPSpark® tag HG14190-ACG
Cystathionase/CTH cDNA ORF Clone, Human, N-GFPSpark® tag HG14190-ANG
Cystathionase/CTH cDNA ORF Clone, Human, C-OFPSpark® tag HG14190-ACR
Cystathionase/CTH cDNA ORF Clone, Human, N-OFPSpark® tag HG14190-ANR
Cystathionase/CTH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14190-CF
Cystathionase/CTH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14190-NF
Cystathionase/CTH cDNA ORF Clone, Human, C-His tag HG14190-CH
Cystathionase/CTH cDNA ORF Clone, Human, N-His tag HG14190-NH
Cystathionase/CTH cDNA ORF Clone, Human, C-HA tag HG14190-CY
Cystathionase/CTH cDNA ORF Clone, Human, N-HA tag HG14190-NY
Cystathionase/CTH cDNA ORF Clone, Human, N-Myc tag HG14190-NM
Cystathionase/CTH qPCR Primer Pairs, Human HP102841
info info
添加购物车成功! 添加购物车失败!