Quick Order

Human NY-ESO-1 Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human CTAG1A cDNA Clone Product Information
    NCBI RefSeq:BC130362
    RefSeq ORF Size:543bp
    cDNA Description:Full length Clone DNA of Homo sapiens cancer/testis antigen 1A with C terminal Myc tag.
    Gene Synonym:ESO1, LAGE2A
    Species:Human
    Vector:pCMV3-C-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CTAG1A qPCR primers for gene expression analysis, HP104230 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    NY-ESO-1 is another well-characterized CT antigen that appears to be the most immunogenic CT antigen known to date. Integrated humoral and cellular immune response against NY-ESO-1 are frequently observed in patients with tumors with NY-ESO-1 expression. As a member of CT antigens, NY-ESO-1 is expressed in a variety of malignant neoplasms, including melanomas, and esophageal, breast, prostate, urinary tract, ovarian, and lung cancers. Recently, immunohistochemical and molecular analytical approaches for the detection of NY-ESO-1 expression were compared, defining the reliability of each method. However, its clinical significance, e.g. in prognosis, in lung cancer is unclear.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Yoshida N, Abe H, Ohkuri T, et al. Expression of the MAGE-A4 and NY-ESO-1 cancer-testis antigens and T cell infiltration in non-small cell lung carcinoma and their prognostic significance[J]. International journal of oncology, 2006, 28(5): 1089-1098.
  • Size / Price
    Catalog: HG15611-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"