Text Size:AAA

Human NY-ESO-1 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human CTAG1A cDNA Clone Product Information
    NCBI RefSeq:BC130362
    RefSeq ORF Size:543bp
    cDNA Description:Full length Clone DNA of Homo sapiens cancer/testis antigen 1A with C terminal HA tag.
    Gene Synonym:ESO1, LAGE2A
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CTAG1A qPCR primers for gene expression analysis, HP104230 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    NY-ESO-1 is another well-characterized CT antigen that appears to be the most immunogenic CT antigen known to date. Integrated humoral and cellular immune response against NY-ESO-1 are frequently observed in patients with tumors with NY-ESO-1 expression. As a member of CT antigens, NY-ESO-1 is expressed in a variety of malignant neoplasms, including melanomas, and esophageal, breast, prostate, urinary tract, ovarian, and lung cancers. Recently, immunohistochemical and molecular analytical approaches for the detection of NY-ESO-1 expression were compared, defining the reliability of each method. However, its clinical significance, e.g. in prognosis, in lung cancer is unclear.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Yoshida N, Abe H, Ohkuri T, et al. Expression of the MAGE-A4 and NY-ESO-1 cancer-testis antigens and T cell infiltration in non-small cell lung carcinoma and their prognostic significance[J]. International journal of oncology, 2006, 28(5): 1089-1098.
  • Size / Price
    Catalog: HG15611-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"