CST9L cDNA ORF Clone, Human, N-Myc tag

Cat: HG13243-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CST9L Reagents
CRO Services
Product recommended

All CST9L Reagents
CST9L cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Human cystatin 9-like with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CST9L cDNA ORF Clone, Human, N-Myc tag Alternative Names
bA218C14.1 cDNA ORF Clone, Human;CTES7B cDNA ORF Clone, Human;PRO3543 cDNA ORF Clone, Human;UNQ1835 cDNA ORF Clone, Human
CST9L Background Information

Testatin is a member of the Cystatin family. Cystatins comprise genes that all show expression patterns that are strikingly restricted to reproductive tissue. Cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. There are typically about 115 amino acids in this family. They are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds, may be glycosylated and/or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Testatin shows homology to family 2 cystatins, a group of broadly expressed small secretory proteins that are inhibitors of cysteine proteases in vitro but whose in vivo functions are unclear. It is expressed in germ cells and somatic cells in reproductive tissues. Testatin is considered a strong candidate for involvement in early testis development. Testatin expression is maintained in the adult Sertoli cell, and it can also be found in a small population of germ cells.

Full Name
cystatin 9-like
References
  • Dickinson DP, et al. (1993) Genomic cloning, physical mapping, and expression of human type 2 cystatin genes. Crit Rev Oral Biol. 4(3-4):573-80.
  • Dickinson DP, et al. (1995) Direct mapping of seven genes encoding human type 2 cystatins to a single site located at 20p11.2. Genomics. 24(1):172-5.
  • Thiesse M, et al. (1994) The human type 2 cystatin gene family consists of eight to nine members, with at least seven genes clustered at a single locus on human chromosome 20. DNA Cell Biol. 13(2): 97-116.
  • info info
    添加购物车成功! 添加购物车失败!