Quick Order

Human CST5 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human CST5 cDNA Clone Product Information
NCBI RefSeq:NM_001900.4
RefSeq ORF Size:429bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin D with C terminal His tag.
Gene Synonym:CST5, MGC71922
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Cystatins are natural inhibitors of papain-like (family C1) and legumain-related (family C13) cysteine peptidases. The mammalian cystatin superfamily members are of three major types, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. As a member of type 2 cystatin, cystatin D is a single-domain protein and also has cysteine residues that form disulfide bridges. In contrast with the wider distribution of all the other family 2 cystatins, cystatin D is tissue-restricted expressed and has been found only in saliva and tears. and meanwhile, it displays an inhibition profile with a preferential inhibition on cathepsin S, H, L. Although the exact functions are largely unknown, it has reported that cystatin D is involved in the inhibition of virus replication and apoptosis.

Size / Price
Catalog: HG10506-CH
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"