Cystatin S cDNA ORF Clone, Human, N-Myc tag

Cat: HG11542-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cystatin S Reagents
CRO Services
Product recommended

All Cystatin S Reagents
Cystatin S cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
426 bp
Description
Full length Clone DNA of Human cystatin S with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cystatin S cDNA ORF Clone, Human, N-Myc tag Alternative Names
CST4 cDNA ORF Clone, Human;MGC71923 cDNA ORF Clone, Human
Cystatin S Background Information

Cystatin-S, also known as Cystatin-4, Salivary acidic protein 1, Cystatin-SA-III and CST4, is a secreted protein which belongs to the cystatin family. Cystatin-4 / CST4 is expressed in submandibular and sublingual saliva but not in parotid saliva (at protein level). It is also expressed in saliva, tears, urine and seminal fluid. The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. Cystatin-4 / CST4 strongly inhibits papain and ficin, partially inhibits stem bromelain and bovine cathepsin C, but does not inhibit porcine cathepsin B or clostripain. Papain is inhibited non-competitively. Cystatin-4 / CST4 is an S-type cystatin, based on its high level of expression in saliva, tears and seminal plasma. The specific role in these fluids is unclear but antibacterial and antiviral activity is present, consistent with a protective function.

Full Name
cystatin S
References
  • Bobek L.A., et al.,(1991), Human salivary cystatin S. Cloning, sequence analysis, hybridization in situ and immunocytochemistry. Biochem. J. 278:627-635.
  • Saitoh E., et al., (1992), Characterization of two members (CST4 and CST5) of the cystatin gene family and molecular evolution of cystatin genes.Agents Actions 38:340-348.
  • Deloukas P., et al.,(2001), The DNA sequence and comparative analysis of human chromosome 20.Nature 414:865-871.
  • info info
    添加购物车成功! 添加购物车失败!