Cystatin SA cDNA ORF Clone, Human, N-Myc tag

Cat: HG11567-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cystatin SA Reagents
CRO Services
Product recommended

All Cystatin SA Reagents
Cystatin SA cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
426 bp
Description
Full length Clone DNA of Human cystatin SA with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cystatin SA cDNA ORF Clone, Human, N-Myc tag Alternative Names
CST2 cDNA ORF Clone, Human;MGC71924 cDNA ORF Clone, Human
Cystatin SA Background Information

Cystatin-SA, also known as Cystatin-2, Cystatin-S5 and CST2, is a secreted protein which belongs to the cystatin family. Cystatin-2 / CST2 is expressed in submandibular and sublingual saliva but not in parotid saliva (at protein level). It is also expressed in submandibular gland and parotid gland. The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The CST1, CST2, CST4, and CST5 are expressed in differential, tissue-specific patterns. Expression of CST2 and CST5 is restricted to the submandibular and parotid glands, while CST1 and CST4 are expressed in these tissues and in the lacrimal gland.

Full Name
cystatin SA
References
  • Saitoh E., et al.,(1987), Human cysteine-proteinase inhibitors: nucleotide sequence analysis of three members of the cystatin gene family. Gene 61:329-338.
  • Zhang Z., et al., (2004), Signal peptide prediction based on analysis of experimentally verified cleavage sites.Protein Sci. 13:2819-2824.
  • Deloukas P., et al.,(2001), The DNA sequence and comparative analysis of human chromosome 20.Nature 414:865-871.
  • info info
    添加购物车成功! 添加购物车失败!