Cystatin SN cDNA ORF Clone, Human, N-Myc tag

Cat: HG11568-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cystatin SN Reagents
CRO Services
Product recommended

All Cystatin SN Reagents
Cystatin SN cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
426 bp
Description
Full length Clone DNA of Human cystatin SN with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cystatin SN cDNA ORF Clone, Human, N-Myc tag Alternative Names
CST1 cDNA ORF Clone, Human
Cystatin SN Background Information

Cystatin-SN, also known as Cystain-SA-I, Cystatin-1, Salivary cystatin-SA-1 and CST1, is a secreted protein which belongs to the cystatin family. The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. Cystatin-SN / CST1 is expressed in submandibular and sublingual saliva but not in parotid saliva (at protein level). Cystatin-SN / CST1 is also expressed in saliva, tears, urine and seminal fluid. Human saliva appears to contain several cysteine proteinase inhibitors that are immunologically related to cystatin S but that differ in their specificity due to amino acid sequence differences. Human salivary cystatins include Cystatin-S, Cystatin-S1, Cystatin-S2, Cystatin- SA, Cystatin-SN, Cystatin-C and Cystatin-D. Cystatin-SN is a much better inhibitor of papain and dipeptidyl peptidase I than is cystatin-S, although both inhibit ficin equally well.

Full Name
cystatin SN
References
  • Saitoh E., et al.,(1987), Human cysteine-proteinase inhibitors: nucleotide sequence analysis of three members of the cystatin gene family. Gene 61:329-338.
  • Al-Hashimi I., et al., (1988), Purification, molecular cloning, and sequencing of salivary cystatin SA-1.J. Biol. Chem. 263:9381-9387.
  • Deloukas P., et al.,(2001), The DNA sequence and comparative analysis of human chromosome 20.Nature 414:865-871.
  • info info
    添加购物车成功! 添加购物车失败!