CSRP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14006-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CSRP3 Reagents
CRO Services
Product recommended

All CSRP3 Reagents
CSRP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Human cysteine and glycine-rich protein 3 (cardiac LIM protein) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CSRP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CLP cDNA ORF Clone, Human;CMD1M cDNA ORF Clone, Human;CMH12 cDNA ORF Clone, Human;CRP3 cDNA ORF Clone, Human;LMO4 cDNA ORF Clone, Human;MLP cDNA ORF Clone, Human
CSRP3 Background Information
Full Name
cysteine and glycine rich protein 3

CSRP3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CSRP3 cDNA ORF Clone in Cloning Vector, Rat RG83620-U
CSRP3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83620-ACGLN

CSRP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CSRP3 cDNA ORF Clone in Cloning Vector, Mouse MG53558-G
CSRP3 cDNA ORF Clone, Mouse, untagged MG53558-UT
CSRP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53558-ACGLN
CSRP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53558-ACG
CSRP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53558-ANG
CSRP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53558-ACR
CSRP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53558-ANR
CSRP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53558-CF
CSRP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53558-NF
CSRP3 cDNA ORF Clone, Mouse, C-His tag MG53558-CH
CSRP3 cDNA ORF Clone, Mouse, N-His tag MG53558-NH
CSRP3 cDNA ORF Clone, Mouse, C-HA tag MG53558-CY
CSRP3 cDNA ORF Clone, Mouse, N-HA tag MG53558-NY
CSRP3 cDNA ORF Clone, Mouse, C-Myc tag MG53558-CM
CSRP3 cDNA ORF Clone, Mouse, N-Myc tag MG53558-NM

CSRP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CSRP3 cDNA ORF Clone in Cloning Vector, Human HG14006-G
CSRP3 cDNA ORF Clone, Human, untagged HG14006-UT
CSRP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14006-ACG
CSRP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14006-ACGLN
CSRP3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14006-ANG
CSRP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14006-ACR
CSRP3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14006-ANR
CSRP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14006-NF
CSRP3 cDNA ORF Clone, Human, C-His tag HG14006-CH
CSRP3 cDNA ORF Clone, Human, N-His tag HG14006-NH
CSRP3 cDNA ORF Clone, Human, C-HA tag HG14006-CY
CSRP3 cDNA ORF Clone, Human, N-HA tag HG14006-NY
CSRP3 cDNA ORF Clone, Human, C-Myc tag HG14006-CM
CSRP3 cDNA ORF Clone, Human, N-Myc tag HG14006-NM
CSRP3 qPCR Primer Pairs, Human HP102662
info info
添加购物车成功! 添加购物车失败!