After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CSRP1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CSRP1 cDNA Clone Product Information
NCBI RefSeq:NM_004078.2
RefSeq ORF Size:582bp
cDNA Description:Full length Clone DNA of Homo sapiens cysteine and glycine-rich protein 1.
Gene Synonym:CRP, CRP1, CSRP, CYRP, D1S181E, DKFZp686M148, CSRP1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CSRP1
Restriction Site:HindIII + XbaI (6.1kb + 0.58kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CSRP1 Gene Plasmid Map
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Mouse Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains two LIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.

References
  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
  • Size / Price
    Catalog: HG11201-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"