CKII alpha prime polypeptide cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11018-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CKII alpha prime polypeptide Reagents
CRO Services
Product recommended

All CKII alpha prime polypeptide Reagents
CKII alpha prime polypeptide cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Human casein kinase 2, alpha prime polypeptide with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CKII alpha prime polypeptide cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CK2A2 cDNA ORF Clone, Human;CSNK2A1 cDNA ORF Clone, Human
CKII alpha prime polypeptide Background Information

Casein kinase II subunit alpha', also known as CSNK2A2 and CK2A2, is a member of the protein kinase superfamily, Ser/Thr protein kinase family and CK2 subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. The alpha and alpha' chains contain the catalytic site. CSNK2A2 is a tetramer composed of an alpha chain, an alpha' and two beta chains. It is also component of a CK2-SPT16-SSRP1 complex composed of SSRP1, SUPT16H, CSNK2A1, CSNK2A2 and CSNK2B, the complex associating following UV irradiation. Protein kinase casein kinase II (Ck2) is a cyclic-AMP and calcium-independent serine-threonine kinase that is composed of two catalytic subunits (alpha and alpha') and two regulatory beta-subunits. Ck2 is not a casein kinase in vivo, but over 100 substrates are known. The highly conserved amino acid sequences of its subunits and their broad expression suggest that Ck2 may have a fundamental role in cell function. Ck2 has been implicated in DNA replication, regulation of basal and inducible transcription, translation and control of metabolism. The Ck2alpha and Ck2alpha' isoforms (products of the genes Csnk2a1 and Csnk2a2, respectively) are highly homologous, the reason for their redundancy and evolutionary conservation is unknown. CSNK2A2 may be a candidate gene for these inherited syndromes.

Full Name
casein kinase 2, alpha prime polypeptide
References
  • Xu X. et al., 1999, Nat Genet. 23 (1):118-21.
  • Aasland M. et al., 2000, Anim Genet. 31 (2):131-4.
  • Escalier D. et al., 2003, Mol Reprod Dev. 66 (2):190-201.
  • Ackermann K. et al., 2005, Mol Cell Biochem. 274 (1-2):91-101.
  • CKII alpha prime polypeptide cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, untagged MG58104-UT
    CKII alpha prime polypeptide Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58104-ACGLN
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58104-ACG
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58104-ANG
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58104-ACR
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58104-ANR
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58104-CF
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58104-NF
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, C-His tag MG58104-CH
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, N-His tag MG58104-NH
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, C-HA tag MG58104-CY
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, N-HA tag MG58104-NY
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, C-Myc tag MG58104-CM
    CKII alpha prime polypeptide cDNA ORF Clone, Mouse, N-Myc tag MG58104-NM

    CKII alpha prime polypeptide cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CKII alpha prime polypeptide cDNA ORF Clone in Cloning Vector, Human HG11018-M
    CKII alpha prime polypeptide cDNA ORF Clone, Human, untagged HG11018-UT
    CKII alpha prime polypeptide cDNA ORF Clone, Human, C-GFPSpark® tag HG11018-ACG
    CKII alpha prime polypeptide Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11018-ACGLN
    CKII alpha prime polypeptide cDNA ORF Clone, Human, N-GFPSpark® tag HG11018-ANG
    CKII alpha prime polypeptide cDNA ORF Clone, Human, C-OFPSpark® tag HG11018-ACR
    CKII alpha prime polypeptide cDNA ORF Clone, Human, N-OFPSpark® tag HG11018-ANR
    CKII alpha prime polypeptide cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11018-NF
    CKII alpha prime polypeptide cDNA ORF Clone, Human, C-His tag HG11018-CH
    CKII alpha prime polypeptide cDNA ORF Clone, Human, N-His tag HG11018-NH
    CKII alpha prime polypeptide cDNA ORF Clone, Human, C-HA tag HG11018-CY
    CKII alpha prime polypeptide cDNA ORF Clone, Human, N-HA tag HG11018-NY
    CKII alpha prime polypeptide cDNA ORF Clone, Human, C-Myc tag HG11018-CM
    CKII alpha prime polypeptide cDNA ORF Clone, Human, N-Myc tag HG11018-NM
    CKII alpha prime polypeptide qPCR Primer Pairs, Human HP100979
    info info
    添加购物车成功! 添加购物车失败!