Quick Order

Human CSNK2A1 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human CSNK2A1 cDNA Clone Product Information
NCBI RefSeq:NM_001895.3
RefSeq ORF Size:1176bp
cDNA Description:Full length Clone DNA of Homo sapiens casein kinase 2, alpha 1 polypeptide with C terminal His tag.
Gene Synonym:CSNK2A1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Casein kinase II subunit alpha, also known as CK II alpha, CSNK2A1 and CK2A1, is a member of the protein kinase superfamily, Ser / Thr protein kinase family and CK2 subfamily. Casein kinase II (CSNK2A1) is a serine / threonine protein kinase that phosphorylates acidic proteins such as casein. This kinase is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. Casein kinase II (CSNK2A1) is a constitutively active, ubiquitously expressed serine / threonine protein kinase that is thought to have a regulatory function in cell proliferation, cell differentiation and apoptosis. CSNK2A1 functions as a tetrameric complex consisting of two regulatory beta-subunits and two catalytic units (alpha and alpha') in a homomeric or heteromeric conformation. Whilst the alpha- and alpha'-subunits are catalytically identical, proteins that regulate CSNK2A1, such as cdc2 and Hsp90, preferentially bind to the alpha and not the alpha'-subunit. CSNK2A1 can phosphorylate a number of key intracellular signaling proteins implicated in tumor suppression (p53 and PTEN) and tumorigenesis (myc, jun, NF-kappaB). CSNK2A1 is also thought to influence Wnt signaling via beta-catenin phosphorylation and the PI 3-K signaling pathway via th phosphorylation of Akt.

References
  • Schlpfer J, et al. (1997) A radiation hybrid framework map of bovine chromosome 13. Chromosome Res. 5(8): 511-9.
  • Wirkner U, et al. (1994) The human gene (CSNK2A1) coding for the casein kinase II subunit alpha is located on chromosome 20 and contains tandemly arranged Alu repeats. Genomics. 19(2): 257-65.
  • Wirkner U, et al. (1998) Genomic organization and promoter identification of the human protein kinase CK2 catalytic subunit alpha (CSNK2A1). Genomics. 48(1): 71-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"