Quick Order

Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CSNK1G3 cDNA Clone Product Information
NCBI RefSeq:NM_001044722.1
RefSeq ORF Size:1248bp
cDNA Description:Full length Clone DNA of Homo sapiens casein kinase 1, gamma 3, transcript variant 3.
Gene Synonym:CSNK1G3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CSNK1G3
Restriction Site:KpnI + XbaI (6.1kb + 1.25kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CSNK1G3 Gene Plasmid Map
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid on other vectors
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10719-ACG$225
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10719-ACR$225
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10719-ANG$225
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10719-ANR$225
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10719-CF$195
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His tagHG10719-CH$195
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10719-CM$195
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG10719-CY$195
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone in cloning vectorHG10719-M$75
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10719-M-F$195
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10719-NF$195
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His tagHG10719-NH$195
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10719-NM$195
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG10719-NY$195
Human CKI gamma 3 transcript variant 3 Gene ORF cDNA clone expression plasmidHG10719-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10719-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"