Casein Kinase 1 alpha cDNA ORF Clone, Human, N-HA tag

Cat: HG10668-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Casein Kinase 1 alpha Reagents
CRO Services
Product recommended

All Casein Kinase 1 alpha Reagents
Casein Kinase 1 alpha cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Description
Full length Clone DNA of Human casein kinase 1, alpha 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Casein Kinase 1 alpha cDNA ORF Clone, Human, N-HA tag Alternative Names
CK1 cDNA ORF Clone, Human;CK1a cDNA ORF Clone, Human;CKIa cDNA ORF Clone, Human;HEL-S-77p cDNA ORF Clone, Human;HLCDGP1 cDNA ORF Clone, Human;PRO2975 cDNA ORF Clone, Human
Casein Kinase 1 alpha Background Information

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

Full Name
casein kinase 1, alpha 1
References
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Casein Kinase 1 alpha cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Casein Kinase 1 alpha cDNA ORF Clone in Cloning Vector, Rat RG84065-U
    Casein Kinase 1 alpha Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84065-ACGLN

    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Casein Kinase 1 alpha cDNA ORF Clone in Cloning Vector, Mouse MG50840-G
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, untagged MG50840-UT
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50840-ACG
    Casein Kinase 1 alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50840-ACGLN
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50840-ANG
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50840-ACR
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50840-ANR
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50840-CF
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50840-NF
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, C-His tag MG50840-CH
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, N-His tag MG50840-NH
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, C-HA tag MG50840-CY
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, N-HA tag MG50840-NY
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, C-Myc tag MG50840-CM
    Casein Kinase 1 alpha cDNA ORF Clone, Mouse, N-Myc tag MG50840-NM
    Casein Kinase 1 alpha qPCR Primer Pairs, Mouse MP200811

    Casein Kinase 1 alpha cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Casein Kinase 1 alpha cDNA ORF Clone in Cloning Vector, Human HG10668-M
    Casein Kinase 1 alpha cDNA ORF Clone, Human, untagged HG10668-UT
    Casein Kinase 1 alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG10668-ACG
    Casein Kinase 1 alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10668-ACGLN
    Casein Kinase 1 alpha cDNA ORF Clone, Human, N-GFPSpark® tag HG10668-ANG
    Casein Kinase 1 alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG10668-ACR
    Casein Kinase 1 alpha cDNA ORF Clone, Human, N-OFPSpark® tag HG10668-ANR
    Casein Kinase 1 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10668-CF
    Casein Kinase 1 alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10668-NF
    Casein Kinase 1 alpha cDNA ORF Clone, Human, C-His tag HG10668-CH
    Casein Kinase 1 alpha cDNA ORF Clone, Human, N-His tag HG10668-NH
    Casein Kinase 1 alpha cDNA ORF Clone, Human, C-HA tag HG10668-CY
    Casein Kinase 1 alpha cDNA ORF Clone, Human, C-Myc tag HG10668-CM
    Casein Kinase 1 alpha cDNA ORF Clone, Human, N-Myc tag HG10668-NM
    Casein Kinase 1 alpha qPCR Primer Pairs, Human HP100635
    info info
    添加购物车成功! 添加购物车失败!