Quick Order

Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CSNK1A1 cDNA Clone Product Information
NCBI RefSeq:NM_001892.4
RefSeq ORF Size:1014bp
cDNA Description:Full length Clone DNA of Homo sapiens casein kinase 1, alpha 1.
Gene Synonym:CK1, HLCDGP1, PRO2975, CSNK1A1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CSNK1A1
Restriction Site:KpnI + XbaI (6.1kb + 1.01kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CSNK1A1 Gene Plasmid Map
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid on other vectors
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10668-ACG$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10668-ACR$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10668-ANG$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10668-ANR$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10668-CF$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10668-CH$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10668-CM$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10668-CY$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone in cloning vectorHG10668-M$75
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10668-M-F$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10668-NF$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10668-NH$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10668-NM$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10668-NY$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmidHG10668-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

References
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    Catalog: HG10668-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"