After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human CSNK1A1 cDNA Clone Product Information
NCBI RefSeq:NM_001892.4
RefSeq ORF Size:1014bp
cDNA Description:Full length Clone DNA of Homo sapiens casein kinase 1, alpha 1 with N terminal HA tag.
Gene Synonym:CK1, HLCDGP1, PRO2975, CSNK1A1
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10668-ACG$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10668-ACR$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10668-ANG$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10668-ANR$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10668-CF$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10668-CH$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10668-CM$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10668-CY$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone in cloning vectorHG10668-M$75
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10668-M-F$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10668-NF$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10668-NH$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10668-NM$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10668-NY$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmidHG10668-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

References
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    Catalog: HG10668-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"