Quick Order

Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CSNK1A1 cDNA Clone Product Information
NCBI RefSeq:NM_001892.4
RefSeq ORF Size:1014bp
cDNA Description:Full length Clone DNA of Homo sapiens casein kinase 1, alpha 1 with C terminal Myc tag.
Gene Synonym:CK1, HLCDGP1, PRO2975, CSNK1A1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Myc tag on other vectors
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10668-ACG$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10668-ACR$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10668-ANG$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10668-ANR$225
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10668-CF$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10668-CH$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10668-CM$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10668-CY$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone in cloning vectorHG10668-M$75
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10668-M-F$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10668-NF$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10668-NH$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10668-NM$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10668-NY$195
Human CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmidHG10668-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

References
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    Catalog: HG10668-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"