Quick Order

Human C-Src Kinase / CSK Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human CSK cDNA Clone Product Information
    NCBI RefSeq:NM_001127190.1
    RefSeq ORF Size:1353bp
    cDNA Description:Full length Clone DNA of Homo sapiens c-src tyrosine kinase with N terminal His tag.
    Gene Synonym:MGC117393, CSK
    Species:Human
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CSK qPCR primers for gene expression analysis, HP100894 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    The tyrosine kinase c-Src has been implicated as a modulator of cell proliferation, spreading, and migration. These functions are also regulated by Met. The structure of a large fragment of the c-Src kinase comprises the regulatory and kinase domains and the carboxy-terminal tall. c-Src kinase interactions among domains and is stabilized by binding of the phosphorylated tail to the SH2 domain. This molecule is locked in a conformation that simultaneously disrupts the kinase active site and sequesters the binding surfaces of the SH2 and SH3 domains. The structure shows how appropriate cellular signals, or transforming mutations in v-Src, could break these interactions to produce an open, active kinase. The protein-tyrosine kinase activity of c-Src kinase is inhibited by phosphorylation of tyr527, within the c-Src c-terminal tail. Genetic and biochemical data have suggested that this negative regulation requires an intact Src homology 2 (SH2) domain. Since SH2 domains recognize phosphotyrosine, it is possible that these two non-catalytic domains associate, and thereby repress c-Src kinase activity. Experiments have suggested that c-Src kinase plays a role in the biological behaviour of colonic carcinoma cells induced by migratory factors such as EGF, perhaps acting in conjunction with FAK to regulate focal adhesion turnover and tumour cell motility. Furthermore, although c-Src kinase has been implicated in colonic tumour progression, in the adenoma to carcinoma in vitro model c-Src is not the driving force for this progression but co-operates with other molecules in carcinoma development.

    References

    References
  • Brauninger A. et al.,1992, Gene. 110: 205-11.
  • Sondhi D. et al., 1999, Biochemistry. 38 (34): 11147-55.
  • Ogawa A. et al., 2002, J Biol Chem. 277 (17): 14351-4.
  • Cole PA. et al., 2003, Curr Opin Chem Biol. 7 (5): 580-5.
  • Baumeister U. et al., 2005,EMBO J. 24 (9): 1686-95.
  • Size / Price
    Catalog: HG10740-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"