Quick Order

Human Placental Lactogen / CSH1 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human CSH1 cDNA Clone Product Information
    NCBI RefSeq:NM_001317.3
    RefSeq ORF Size:654bp
    cDNA Description:Full length Clone DNA of Homo sapiens chorionic somatomammotropin hormone 1 (placental lactogen) with N terminal Myc tag.
    Gene Synonym:CSH1
    Species:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CSH1 qPCR primers for gene expression analysis, HP101459 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Chorionic somatomammotropin hormone, also known as Choriomammotropin, Lactogen, Placental lactogen and CSH1, is a secreted protein which belongs to the somatotropin / prolactin family. CSH1 is produced only during pregnancy and is involved in stimulating lactation, fetal growth and metabolism. Does not interact with GHR but only activates PRLR through zinc-induced dimerization. The CSH1 gene is member of the GH gene cluster on 17q, which consists of two growth hormone genes and three CSH genes. Genomic alterations in the GH cluster are well known, causing different phenotypes depending on the size of the deletion and the genes involved. The increased prevalence of hemizygosity of CSH1 in population in comparison to controls indicates a role for CSH1 haploinsufficiency in the etiology of growth retardation. Investigation of CSH1 deletions in further SRS and growth retarded patients will enable us to establish under which circumstances haploinsufficiency of CSH1 is likely to result in clinical changes.

    References
  • Prager,S. et al., 2003,Genet Test. 7 (3):259-63.
  • Singleton, DR. et al., 2004, Microbiology. 150 (Pt 2): 285-92.
  • Chen,Y. et al., 2008, Cancer Res. 68 (23):9729-34.
  • Size / Price
    Catalog: HG11596-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"