CSGALNACT2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11522-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CSGALNACT2 Reagents
CRO Services
Product recommended

All CSGALNACT2 Reagents
CSGALNACT2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1629 bp
Description
Full length Clone DNA of Human chondroitin sulfate N-acetylgalactosaminyltransferase 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CSGALNACT2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CHGN2 cDNA ORF Clone, Human;GALNACT-2 cDNA ORF Clone, Human;GALNACT2 cDNA ORF Clone, Human;PRO0082 cDNA ORF Clone, Human
CSGALNACT2 Background Information
Full Name
chondroitin sulfate N-acetylgalactosaminyltransferase 2

CSGALNACT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CSGALNACT2 cDNA ORF Clone in Cloning Vector, Mouse MG5A3474-U
CSGALNACT2 cDNA ORF Clone, Mouse, untagged MG5A3474-UT
CSGALNACT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3474-ACGLN
CSGALNACT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3474-ACG
CSGALNACT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3474-ANG
CSGALNACT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3474-ACR
CSGALNACT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3474-ANR
CSGALNACT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3474-CF
CSGALNACT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3474-NF
CSGALNACT2 cDNA ORF Clone, Mouse, C-His tag MG5A3474-CH
CSGALNACT2 cDNA ORF Clone, Mouse, N-His tag MG5A3474-NH
CSGALNACT2 cDNA ORF Clone, Mouse, C-HA tag MG5A3474-CY
CSGALNACT2 cDNA ORF Clone, Mouse, N-HA tag MG5A3474-NY
CSGALNACT2 cDNA ORF Clone, Mouse, C-Myc tag MG5A3474-CM
CSGALNACT2 cDNA ORF Clone, Mouse, N-Myc tag MG5A3474-NM

CSGALNACT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CSGALNACT2 cDNA ORF Clone in Cloning Vector, Human HG11522-M
CSGALNACT2 cDNA ORF Clone, Human, untagged HG11522-UT
CSGALNACT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11522-ACGLN
CSGALNACT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11522-ACG
CSGALNACT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11522-ACR
CSGALNACT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11522-CF
CSGALNACT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11522-NF
CSGALNACT2 cDNA ORF Clone, Human, C-His tag HG11522-CH
CSGALNACT2 cDNA ORF Clone, Human, N-His tag HG11522-NH
CSGALNACT2 cDNA ORF Clone, Human, C-HA tag HG11522-CY
CSGALNACT2 cDNA ORF Clone, Human, N-HA tag HG11522-NY
CSGALNACT2 cDNA ORF Clone, Human, C-Myc tag HG11522-CM
CSGALNACT2 qPCR Primer Pairs, Human HP101393
info info
添加购物车成功! 添加购物车失败!