After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human G-CSF R/CD114/CSF3R transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human CSF3R cDNA Clone Product Information
NCBI RefSeq:NM_000760.2
RefSeq ORF Size:2511bp
cDNA Description:Full length Clone DNA of Homo sapiens colony stimulating factor 3 receptor (granulocyte), transcript variant 1 with N terminal His tag.
Gene Synonym:CSF3R, CD114, GCSFR
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Granulocyte Colony Stimulating Factor Receptor (G-CSFR), also known as CD114, which belongs to the cytokine receptor superfamily, is a cell surface receptor for colony stimulating factor 3 (CSF3). It is a critical regulator of granulopoiesis. This type I membrane protein has a composite structure consisting of an immunoglobulin(Ig)-like domain, a cytokine receptor-homologous (CRH) domain and three fibronectin type III (FNIII) domains in the extracellular region. Mutations in the G-CSF receptor leading to carboxy-terminal truncation transduce hyperproliferative growth responses, and are implicated in the pathological progression of severe congenital neutropenia (SCN) to acute myelogenous leukemia (AML). Additionally, autocrine/paracrine stimulation of G-CSFR may be important in the biology of solid tumors, including metastasis.

References
  • Kasper B, et al. (1999) Association of src-kinase Lyn and non-src-kinase Syk with the granulocyte colony-stimulating factor receptor (G-CSFR) is not abrogated in neutrophils from severe congenital neutropenia patients with point mutations in the G-CSFR mRNA. Int J Hematol. 70(4): 241-7.
  • Hollenstein U, et al. (2000) Endotoxin down-modulates granulocyte colony-stimulating factor receptor (CD114) on human neutrophils. J Infect Dis. 182(1): 343-6.
  • Kindwall-Keller TL, et al. (2008) Role of the proteasome in modulating native G-CSFR expression. Cytokine. 43(2): 114-23.
  • Beel K, et al. (2009) G-CSF receptor (CSF3R) mutations in X-linked neutropenia evolving to acute myeloid leukemia or myelodysplasia. Haematologica. 94(10): 1449-52.
  •  

    G-CSFR/CD114 related areas, pathways, and other information

    Size / Price
    Catalog: HG10218-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"