Citrate Synthase cDNA ORF Clone, Human, N-HA tag

Cat: HG14083-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Citrate Synthase Reagents
CRO Services
Product recommended

All Citrate Synthase Reagents
Citrate Synthase cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1401 bp
Description
Full length Clone DNA of Human citrate synthase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Citrate Synthase Background Information
Full Name
citrate synthase

Citrate Synthase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Citrate Synthase cDNA ORF Clone in Cloning Vector, Mouse MG52549-U
Citrate Synthase cDNA ORF Clone, Mouse, untagged MG52549-UT
Citrate Synthase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52549-ACGLN
Citrate Synthase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52549-ACG
Citrate Synthase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52549-ANG
Citrate Synthase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52549-ACR
Citrate Synthase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52549-ANR
Citrate Synthase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52549-CF
Citrate Synthase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52549-NF
Citrate Synthase cDNA ORF Clone, Mouse, C-His tag MG52549-CH
Citrate Synthase cDNA ORF Clone, Mouse, N-His tag MG52549-NH
Citrate Synthase cDNA ORF Clone, Mouse, C-HA tag MG52549-CY
Citrate Synthase cDNA ORF Clone, Mouse, N-HA tag MG52549-NY
Citrate Synthase cDNA ORF Clone, Mouse, C-Myc tag MG52549-CM
Citrate Synthase cDNA ORF Clone, Mouse, N-Myc tag MG52549-NM
Citrate Synthase qPCR Primer Pairs, Mouse MP202422

Citrate Synthase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Citrate Synthase cDNA ORF Clone in Cloning Vector, Human HG14083-G
Citrate Synthase cDNA ORF Clone, Human, untagged HG14083-UT
Citrate Synthase cDNA ORF Clone, Human, C-GFPSpark® tag HG14083-ACG
Citrate Synthase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14083-ACGLN
Citrate Synthase cDNA ORF Clone, Human, N-GFPSpark® tag HG14083-ANG
Citrate Synthase cDNA ORF Clone, Human, C-OFPSpark® tag HG14083-ACR
Citrate Synthase cDNA ORF Clone, Human, N-OFPSpark® tag HG14083-ANR
Citrate Synthase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14083-CF
Citrate Synthase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14083-NF
Citrate Synthase cDNA ORF Clone, Human, C-His tag HG14083-CH
Citrate Synthase cDNA ORF Clone, Human, N-His tag HG14083-NH
Citrate Synthase cDNA ORF Clone, Human, C-HA tag HG14083-CY
Citrate Synthase cDNA ORF Clone, Human, C-Myc tag HG14083-CM
Citrate Synthase cDNA ORF Clone, Human, N-Myc tag HG14083-NM
Citrate Synthase qPCR Primer Pairs, Human HP102737
info info
添加购物车成功! 添加购物车失败!