CRTAM cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11975-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CRTAM Reagents
CRO Services
Product recommended

All CRTAM Reagents
CRTAM cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Description
Full length Clone DNA of Human cytotoxic and regulatory T cell molecule with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRTAM cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD355 cDNA ORF Clone, Human
CRTAM Background Information

Cytotoxic and regulatory T-cell molecule, also known as Class-I MHC-restricted T-cell-associated molecule and CRTAM, is a single-pass type I  membrane protein which belongs to the nectin family. CRTAM contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. In the immune system, the expression of CRTAM is restricted to activated class-I MHC-restricted cells, including NKT and CD8 cells. It is strongly expressed in spleen, thymus, small intestine, peripheral blood leukocyte, and in purkinje neurons in cerebellum. It is expressed at much lower levels in testis, ovary, colon, lung and lymphoid tissues. CRTAM is a member of the immunoglobulin superfamily that complies with the structural characteristics of the JAM family of proteins and is phylogenetically more closely related to nectin-like proteins. It is a molecule involved in epithelial cell adhesion. CRTAM is sensitive to intermediate filament disruption and treatment of monolayers with soluble CRTAM enhances cell-cell dissociation and lowers transepithelial electrical resistance. CRTAM may also induce retention by binding to CD8+ dendritic cells (DCs) at the late stage of activation before proliferation. 

Full Name
cytotoxic and regulatory T cell molecule
References
  • Garay, E. et al., 2010, J Cell Biochem. 111 (1):111-22.
  • Medina-C.O. et al., 2010, Dev Comp Immunol. 34 (2):196-202.
  • Takeuchi, A. et al., 2009, J Immunol.183 (7):4220-8.
  • Valle-Rios,R. et al., 2009, Mol Immunol. 46 (16): 3379-87.
  • info info
    添加购物车成功! 添加购物车失败!