C-Reactive Protein cDNA ORF Clone, Human, C-His tag

Cat: HG11250-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All C-Reactive Protein Reagents
CRO Services
Product recommended

All C-Reactive Protein Reagents
C-Reactive Protein cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
675 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human C-reactive protein, pentraxin-related with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI (6kb + 0.72kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
C-Reactive Protein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C-Reactive Protein cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
C-Reactive Protein cDNA ORF Clone, Human, C-His tag Alternative Names
C-Reactive Protein cDNA ORF Clone, Human;PTX1 cDNA ORF Clone, Human
C-Reactive Protein Background Information

C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It is a member of the pentraxin family of proteins. The levels of CRP rise in response to inflammation. Human C-reactive protein (CRP) is the classical acute phase reactant, the circulating concentration of which rises rapidly and extensively in a cytokine-mediated response to tissue injury, infection and inflammation. Serum CRP values are routinely measured, empirically, to detect and monitor many human diseases. However, CRP is likely to have important host defence, scavenging and metabolic functions through its capacity for calcium-dependent binding to exogenous and autologous molecules containing phosphocholine (PC) and then activating the classical complement pathway. CRP may also have pathogenic effects and the recent discovery of a prognostic association between increased CRP production and coronary atherothrombotic events is of particular interest.

Full Name
C-reactive protein, pentraxin-related
References
  • Pepys MB. et al., 2003, J Clin Invest. 111 (12): 1805-12.
  • Thompson D. et al., 1999, Structure. 7(2): 169-77.
  • C-Reactive Protein cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    C-Reactive Protein cDNA ORF Clone in Cloning Vector, Rhesus CG90002-G
    C-Reactive Protein cDNA ORF Clone, Rhesus, untagged CG90002-UT
    C-Reactive Protein Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90002-ACGLN
    C-Reactive Protein cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90002-ACG
    C-Reactive Protein cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90002-ACR
    C-Reactive Protein cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90002-CF
    C-Reactive Protein cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90002-NF
    C-Reactive Protein cDNA ORF Clone, Rhesus, C-His tag CG90002-CH
    C-Reactive Protein cDNA ORF Clone, Rhesus, N-His tag CG90002-NH
    C-Reactive Protein cDNA ORF Clone, Rhesus, C-HA tag CG90002-CY
    C-Reactive Protein cDNA ORF Clone, Rhesus, N-HA tag CG90002-NY
    C-Reactive Protein cDNA ORF Clone, Rhesus, C-Myc tag CG90002-CM
    C-Reactive Protein cDNA ORF Clone, Rhesus, N-Myc tag CG90002-NM

    C-Reactive Protein cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    C-Reactive Protein cDNA ORF Clone in Cloning Vector, Rat RG80041-M
    C-Reactive Protein cDNA ORF Clone, Rat, untagged RG80041-UT
    C-Reactive Protein Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80041-ACGLN
    C-Reactive Protein cDNA ORF Clone, Rat, C-GFPSpark® tag RG80041-ACG
    C-Reactive Protein cDNA ORF Clone, Rat, C-OFPSpark® tag RG80041-ACR
    C-Reactive Protein cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80041-CF
    C-Reactive Protein cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80041-NF
    C-Reactive Protein cDNA ORF Clone, Rat, C-His tag RG80041-CH
    C-Reactive Protein cDNA ORF Clone, Rat, N-His tag RG80041-NH
    C-Reactive Protein cDNA ORF Clone, Rat, C-HA tag RG80041-CY
    C-Reactive Protein cDNA ORF Clone, Rat, N-HA tag RG80041-NY
    C-Reactive Protein cDNA ORF Clone, Rat, C-Myc tag RG80041-CM
    C-Reactive Protein cDNA ORF Clone, Rat, N-Myc tag RG80041-NM
    C-Reactive Protein qPCR Primer Pairs, Rat RP300040

    C-Reactive Protein cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    C-Reactive Protein cDNA ORF Clone in Cloning Vector, Mouse MG50409-M
    C-Reactive Protein cDNA ORF Clone, Mouse, untagged MG50409-UT
    C-Reactive Protein Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50409-ACGLN
    C-Reactive Protein cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50409-ACG
    C-Reactive Protein cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50409-ACR
    C-Reactive Protein cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50409-CF
    C-Reactive Protein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50409-NF
    C-Reactive Protein cDNA ORF Clone, Mouse, C-His tag MG50409-CH
    C-Reactive Protein cDNA ORF Clone, Mouse, N-His tag MG50409-NH
    C-Reactive Protein cDNA ORF Clone, Mouse, C-HA tag MG50409-CY
    C-Reactive Protein cDNA ORF Clone, Mouse, N-HA tag MG50409-NY
    C-Reactive Protein cDNA ORF Clone, Mouse, C-Myc tag MG50409-CM
    C-Reactive Protein cDNA ORF Clone, Mouse, N-Myc tag MG50409-NM
    C-Reactive Protein qPCR Primer Pairs, Mouse MP200086

    C-Reactive Protein cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    C-Reactive Protein cDNA ORF Clone in Cloning Vector, Human HG11250-M
    C-Reactive Protein cDNA ORF Clone, Human, untagged HG11250-UT
    C-Reactive Protein Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11250-ACGLN
    C-Reactive Protein cDNA ORF Clone, Human, C-GFPSpark® tag HG11250-ACG
    C-Reactive Protein cDNA ORF Clone, Human, C-OFPSpark® tag HG11250-ACR
    C-Reactive Protein cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11250-CF
    C-Reactive Protein cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11250-NF
    C-Reactive Protein cDNA ORF Clone, Human, N-His tag HG11250-NH
    C-Reactive Protein cDNA ORF Clone, Human, C-HA tag HG11250-CY
    C-Reactive Protein cDNA ORF Clone, Human, N-HA tag HG11250-NY
    C-Reactive Protein cDNA ORF Clone, Human, C-Myc tag HG11250-CM
    C-Reactive Protein cDNA ORF Clone, Human, N-Myc tag HG11250-NM
    C-Reactive Protein qPCR Primer Pairs, Human HP101134
    info info
    添加购物车成功! 添加购物车失败!