CRKL cDNA ORF Clone, Human, C-His tag

Cat: HG11261-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CRKL Reagents
CRO Services
Product recommended

All CRKL Reagents
CRKL cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
912 bp
Description
Full length Clone DNA of Human v-crk sarcoma virus CT10 oncogene homolog (avian)-like with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRKL Background Information
Full Name
v-crk avian sarcoma virus CT10 oncogene homolog-like

CRKL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CRKL cDNA ORF Clone in Cloning Vector, Mouse MG50548-M
CRKL cDNA ORF Clone, Mouse, untagged MG50548-UT
CRKL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50548-ACGLN
CRKL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50548-ACG
CRKL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50548-ANG
CRKL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50548-ACR
CRKL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50548-ANR
CRKL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50548-CF
CRKL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50548-NF
CRKL cDNA ORF Clone, Mouse, C-His tag MG50548-CH
CRKL cDNA ORF Clone, Mouse, N-His tag MG50548-NH
CRKL cDNA ORF Clone, Mouse, C-HA tag MG50548-CY
CRKL cDNA ORF Clone, Mouse, N-HA tag MG50548-NY
CRKL cDNA ORF Clone, Mouse, C-Myc tag MG50548-CM
CRKL cDNA ORF Clone, Mouse, N-Myc tag MG50548-NM
CRKL qPCR Primer Pairs, Mouse MP200540

CRKL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CRKL cDNA ORF Clone in Cloning Vector, Human HG11261-M
CRKL cDNA ORF Clone, Human, untagged HG11261-UT
CRKL cDNA ORF Clone, Human, C-GFPSpark® tag HG11261-ACG
CRKL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11261-ACGLN
CRKL cDNA ORF Clone, Human, N-GFPSpark® tag HG11261-ANG
CRKL cDNA ORF Clone, Human, C-OFPSpark® tag HG11261-ACR
CRKL cDNA ORF Clone, Human, N-OFPSpark® tag HG11261-ANR
CRKL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11261-CF
CRKL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11261-NF
CRKL cDNA ORF Clone, Human, N-His tag HG11261-NH
CRKL cDNA ORF Clone, Human, C-HA tag HG11261-CY
CRKL cDNA ORF Clone, Human, N-HA tag HG11261-NY
CRKL cDNA ORF Clone, Human, C-Myc tag HG11261-CM
CRKL cDNA ORF Clone, Human, N-Myc tag HG11261-NM
CRKL qPCR Primer Pairs, Human HP101145
info info
添加购物车成功! 添加购物车失败!