CRISP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10996-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CRISP3 Reagents
CRO Services
Product recommended

All CRISP3 Reagents
CRISP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Human cysteine-rich secretory protein 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRISP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human CRISP3 Gene Expression validated Image 16935
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
CRISP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
Aeg2 cDNA ORF Clone, Human;CRISP-3 cDNA ORF Clone, Human;CRS3 cDNA ORF Clone, Human;dJ442L6.3 cDNA ORF Clone, Human;SGP28 cDNA ORF Clone, Human
CRISP3 Background Information
Full Name
cysteine-rich secretory protein 3

CRISP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CRISP3 cDNA ORF Clone, Mouse, untagged MG5A2111-UT
CRISP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2111-ACG
CRISP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2111-ACGLN
CRISP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2111-ACR
CRISP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2111-CF
CRISP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2111-NF
CRISP3 cDNA ORF Clone, Mouse, C-His tag MG5A2111-CH
CRISP3 cDNA ORF Clone, Mouse, N-His tag MG5A2111-NH
CRISP3 cDNA ORF Clone, Mouse, C-HA tag MG5A2111-CY
CRISP3 cDNA ORF Clone, Mouse, N-HA tag MG5A2111-NY
CRISP3 cDNA ORF Clone, Mouse, C-Myc tag MG5A2111-CM
CRISP3 cDNA ORF Clone, Mouse, N-Myc tag MG5A2111-NM

CRISP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CRISP3 cDNA ORF Clone in Cloning Vector, Human HG10996-M
CRISP3 cDNA ORF Clone, Human, untagged HG10996-UT
CRISP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10996-ACG
CRISP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10996-ACGLN
CRISP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10996-ACR
CRISP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10996-NF
CRISP3 cDNA ORF Clone, Human, C-His tag HG10996-CH
CRISP3 cDNA ORF Clone, Human, N-His tag HG10996-NH
CRISP3 cDNA ORF Clone, Human, C-HA tag HG10996-CY
CRISP3 cDNA ORF Clone, Human, N-HA tag HG10996-NY
CRISP3 cDNA ORF Clone, Human, C-Myc tag HG10996-CM
CRISP3 cDNA ORF Clone, Human, N-Myc tag HG10996-NM
CRISP3 qPCR Primer Pairs, Human HP100958
info info
添加购物车成功! 添加购物车失败!