Quick Order

Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CRIPT cDNA Clone Product Information
NCBI RefSeq:BC006980
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Homo sapiens cysteine-rich PDZ-binding protein with N terminal Flag tag.
Gene Synonym:HSPC139
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG14560-ACG$225
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG14560-ACR$225
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG14560-ANG$225
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG14560-ANR$225
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-Flag tagHG14560-CF$195
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-His tagHG14560-CH$195
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-Myc tagHG14560-CM$195
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, C-HA tagHG14560-CY$195
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone in cloning vectorHG14560-G$75
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-Flag tagHG14560-NF$195
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-His tagHG14560-NH$195
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-Myc tagHG14560-NM$195
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmid, N-HA tagHG14560-NY$195
Human CRIPT / cysteine-rich PDZ-binding protein Gene ORF cDNA clone expression plasmidHG14560-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also interacts strongly with the PDZ3 domain of members of the DLG4 family. It is involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. CRIPT is highly conserved from mammals to plants and binds selectively to the third PDZ domain (PDZ3) of PSD-95 via its C terminus. n heterologous cells, CRIPT causes a redistribution of PSD-95 to microtubules. In brain, CRIPT colocalizes with PSD-95 in the postsynaptic density and can be coimmunoprecipitated with PSD-95 and tubulin. These findings suggest that CRIPT may regulate PSD-95 interaction with a tubulin-based cytoskeleton in excitatory synapses.

References
  • Niethammer M. et al., 1998,Neuron. 20 (4): 693-707.
  • Passafaro M. et al., 2000, Nat Neurosci. 2 (12): 1063-9.
  • Piserchio A. et al., 2002, J Biol Chem. 277 (9): 6967-73.
  • Fukunaga Y. et al., 2005, J Biochem. 138 (2): 177-82.
  • Size / Price
    Catalog: HG14560-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"