CRELD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13411-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CRELD1 Reagents
CRO Services
Product recommended

All CRELD1 Reagents
CRELD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1263 bp
Description
Full length Clone DNA of Human cysteine-rich with EGF-like domains 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRELD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
AVSD2 cDNA ORF Clone, Human;CIRRIN cDNA ORF Clone, Human
CRELD1 Background Information

CRELD1 is a transmembrane glycoprotein. Epidermal growth factor(EGF)­like domain exists in CRELD1. EGF-like repeats are a class of cysteine-rich domains that mediate interactions between proteins of diverse function. EGF domains are found in proteins that are either completely secreted or have transmembrane regions that tether the protein to the cell surface. CRELD1 contains a 333 amino acid acid (aa) extracellular domain (ECD), two tandem transmembrane segments, and a second ECD of 15 aa. Defects in CRELD1 may cause susceptibility to atrioventricular septal defect type 2 which results in a persistent common atrioventricular canal.

Full Name
cysteine-rich with EGF-like domains 1
References
  • Robinson SW, et al. (2003) Missense Mutations in CRELD1 Are Associated with Cardiac Atrioventricular Septal Defects. Am J Hum Genet. 72(4):1047-52.
  • Zatyka M, et al. (2005) Analysis of CRELD1 as a candidate 3p25 atrioventicular septal defect locus (AVSD2). Clin Genet. 67(6):526-8.
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • CRELD1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CRELD1 cDNA ORF Clone in Cloning Vector, Mouse MG51149-G
    CRELD1 cDNA ORF Clone, Mouse, untagged MG51149-UT
    CRELD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51149-ACG
    CRELD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51149-ACGLN
    CRELD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51149-ACR
    CRELD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51149-CF
    CRELD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51149-NF
    CRELD1 cDNA ORF Clone, Mouse, C-His tag MG51149-CH
    CRELD1 cDNA ORF Clone, Mouse, N-His tag MG51149-NH
    CRELD1 cDNA ORF Clone, Mouse, C-HA tag MG51149-CY
    CRELD1 cDNA ORF Clone, Mouse, N-HA tag MG51149-NY
    CRELD1 cDNA ORF Clone, Mouse, C-Myc tag MG51149-CM
    CRELD1 cDNA ORF Clone, Mouse, N-Myc tag MG51149-NM

    CRELD1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CRELD1 cDNA ORF Clone in Cloning Vector, Human HG13411-G
    CRELD1 cDNA ORF Clone, Human, untagged HG13411-UT
    CRELD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13411-ACG
    CRELD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13411-ACGLN
    CRELD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13411-ACR
    CRELD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13411-NF
    CRELD1 cDNA ORF Clone, Human, C-His tag HG13411-CH
    CRELD1 cDNA ORF Clone, Human, N-His tag HG13411-NH
    CRELD1 cDNA ORF Clone, Human, C-HA tag HG13411-CY
    CRELD1 cDNA ORF Clone, Human, N-HA tag HG13411-NY
    CRELD1 cDNA ORF Clone, Human, C-Myc tag HG13411-CM
    CRELD1 cDNA ORF Clone, Human, N-Myc tag HG13411-NM
    CRELD1 qPCR Primer Pairs, Human HP102113
    info info
    添加购物车成功! 添加购物车失败!