After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CRELD1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CRELD1 cDNA Clone Product Information
NCBI RefSeq:NM_015513.4
RefSeq ORF Size:1263bp
cDNA Description:Full length Clone DNA of Homo sapiens cysteine-rich with EGF-like domains 1.
Gene Synonym:AVSD2, CIRRIN, CRELD1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CRELD1 is a transmembrane glycoprotein. Epidermal growth factor(EGF)­like domain exists in CRELD1. EGF-like repeats are a class of cysteine-rich domains that mediate interactions between proteins of diverse function. EGF domains are found in proteins that are either completely secreted or have transmembrane regions that tether the protein to the cell surface. CRELD1 contains a 333 amino acid acid (aa) extracellular domain (ECD), two tandem transmembrane segments, and a second ECD of 15 aa. Defects in CRELD1 may cause susceptibility to atrioventricular septal defect type 2 which results in a persistent common atrioventricular canal.

References
  • Robinson SW, et al. (2003) Missense Mutations in CRELD1 Are Associated with Cardiac Atrioventricular Septal Defects. Am J Hum Genet. 72(4):1047-52.
  • Zatyka M, et al. (2005) Analysis of CRELD1 as a candidate 3p25 atrioventicular septal defect locus (AVSD2). Clin Genet. 67(6):526-8.
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"