CREB cDNA ORF Clone, Human, C-Myc tag

Cat: HG10074-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CREB Reagents
CRO Services
Product recommended

All CREB Reagents
CREB cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
984 bp
Description
Full length Clone DNA of Human cAMP responsive element binding protein 1, transcript variant A with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CREB cDNA ORF Clone, Human, C-Myc tag Alternative Names
CREB cDNA ORF Clone, Human
CREB Background Information

CAMP responsive element binding protein 1, also known as CREB-1, plays multiple functions as a transcription factor in gene regulation. This protein is a CREB transcription factor that is a member of the leucine zipper family of DNA-binding proteins. CREB1 proteins are also known to be expressed in several spliced isoforms that act as transcriptional activators or repressors. The activator isoforms, possessing the functional domains for kinase induction and for interaction with other transcriptional regulators, act as transcriptional activators.The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. CREB-1 has a complex influence on behavioural responses to drugs of abuse which varies depending on the brain region in which it is expressed. CREB-1 is important for serotonin (5-HT)-induced long-term facilitation (LTF) of the sensorimotor synapse in Aplysia. 

Full Name
cAMP responsive element binding protein 1
References
  • Sadamoto H, et al. (2011) Direct observation of dimerization between different CREB1 isoforms in a living cell. PLoS One. 6 (6): e20285.
  • Liu RY, et al. (2011) The requirement for enhanced CREB1 expression in consolidation of long-term synaptic facilitation and long-term excitability in sensory neurons of Aplysia. J Neurosci. 31 (18): 6871-9.
  • Hoeffler JP, et al. (1988) Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science. 242 (4884): 1430-3.
  • CREB cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CREB cDNA ORF Clone in Cloning Vector, Mouse MG51953-G
    CREB cDNA ORF Clone, Mouse, untagged MG51953-UT
    CREB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51953-ACGLN
    CREB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51953-ACG
    CREB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51953-ANG
    CREB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51953-ACR
    CREB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51953-ANR
    CREB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51953-CF
    CREB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51953-NF
    CREB cDNA ORF Clone, Mouse, C-His tag MG51953-CH
    CREB cDNA ORF Clone, Mouse, N-His tag MG51953-NH
    CREB cDNA ORF Clone, Mouse, C-HA tag MG51953-CY
    CREB cDNA ORF Clone, Mouse, N-HA tag MG51953-NY
    CREB cDNA ORF Clone, Mouse, C-Myc tag MG51953-CM
    CREB cDNA ORF Clone, Mouse, N-Myc tag MG51953-NM
    CREB qPCR Primer Pairs, Mouse MP201826

    CREB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CREB cDNA ORF Clone in Cloning Vector, Human HG10074-G
    CREB cDNA ORF Clone, Human, untagged HG10074-UT
    CREB cDNA ORF Clone, Human, C-GFPSpark® tag HG10074-ACG
    CREB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10074-ACGLN
    CREB cDNA ORF Clone, Human, N-GFPSpark® tag HG10074-ANG
    CREB cDNA ORF Clone, Human, C-OFPSpark® tag HG10074-ACR
    CREB cDNA ORF Clone, Human, N-OFPSpark® tag HG10074-ANR
    CREB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10074-CF
    CREB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10074-NF
    CREB cDNA ORF Clone, Human, C-His tag HG10074-CH
    CREB cDNA ORF Clone, Human, N-His tag HG10074-NH
    CREB cDNA ORF Clone, Human, C-HA tag HG10074-CY
    CREB cDNA ORF Clone, Human, N-HA tag HG10074-NY
    CREB cDNA ORF Clone, Human, N-Myc tag HG10074-NM
    CREB qPCR Primer Pairs, Human HP100160
    info info
    添加购物车成功! 添加购物车失败!