Quick Order

Text Size:AAA

Human CREB1 transcript variant A Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CREB1 cDNA Clone Product Information
NCBI RefSeq:NM_004379.2
RefSeq ORF Size:984bp
cDNA Description:Full length Clone DNA of Homo sapiens cAMP responsive element binding protein 1, transcript variant A with N terminal Flag tag.
Gene Synonym:CREB1, CREB, MGC9284
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-CREB1
Restriction Site:HindIII + XbaI (6kb + 1.03kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CREB1 Gene Plasmid Map
Human CREB1 transcript variant A natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CREB1 transcript variant A Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
Product nameProduct name
Background

CAMP responsive element binding protein 1, also known as CREB-1, plays multiple functions as a transcription factor in gene regulation. This protein is a CREB transcription factor that is a member of the leucine zipper family of DNA-binding proteins. CREB1 proteins are also known to be expressed in several spliced isoforms that act as transcriptional activators or repressors. The activator isoforms, possessing the functional domains for kinase induction and for interaction with other transcriptional regulators, act as transcriptional activators.The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. CREB-1 has a complex influence on behavioural responses to drugs of abuse which varies depending on the brain region in which it is expressed. CREB-1 is important for serotonin (5-HT)-induced long-term facilitation (LTF) of the sensorimotor synapse in Aplysia. 

References
  • Sadamoto H, et al. (2011) Direct observation of dimerization between different CREB1 isoforms in a living cell. PLoS One. 6 (6): e20285.
  • Liu RY, et al. (2011) The requirement for enhanced CREB1 expression in consolidation of long-term synaptic facilitation and long-term excitability in sensory neurons of Aplysia. J Neurosci. 31 (18): 6871-9.
  • Hoeffler JP, et al. (1988) Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science. 242 (4884): 1430-3.
  • Size / Price
    Catalog: HG10074-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human CREB1 transcript variant A natural ORF mammalian expression plasmid, N-Flag tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"