Quick Order

Human CRABP1 / CRABP-I Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CRABP1 cDNA Clone Product Information
NCBI RefSeq:BC022069
RefSeq ORF Size:414bp
cDNA Description:Full length Clone DNA of Homo sapiens cellular retinoic acid binding protein 1.
Gene Synonym:RBP5, CRABP, CRABPI, CRABP-I
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CRABP1 is a specific binding protein for a vitamin A family member. It is thought that CRABP1 plays an important role in retinoic acid-mediated differentiation and proliferation processes. CRABP1 is structurally similar to the cellular retinol-binding proteins, but binds only retinoic acid at specific sites within the nucleus, which may contribute to vitamin A-directed differentiation in epithelial tissue. It forms a beta-barrel structure which accommodates hydrophobic ligands in its interior.

References
  • Wu Q. et al., 2007, Mol Cancer. 6: 45.
  • Tanaka K. et al., 2007, Oncogene. 26 (44): 6456-68.
  • Lind GE. et al., 2007, Cell Oncol. 28 (5-6): 259-72.
  • Size / Price
    Catalog: HG14511-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"