Text Size:AAA

Human CPSF3/CPSF73 Gene ORF cDNA clone expression plasmid

  • Human CPSF3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human CPSF3 cDNA Clone Product Information
NCBI RefSeq:NM_016207.2
RefSeq ORF Size:2055bp
cDNA Description:Full length Clone DNA of Homo sapiens cleavage and polyadenylation specific factor 3, 73kDa.
Gene Synonym:CPSF, YSH1, CPSF73, CPSF-73, CPSF3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CPSF3
Restriction Site:KpnI + PmeI (6.1kb + 2.06kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CPSF3 qPCR primers for gene expression analysis, HP101356 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CPSF3 Gene Plasmid Map
Human CPSF3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11480-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"