CPNE1 cDNA ORF Clone, Human, N-His tag

Cat: HG14283-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CPNE1 Reagents
CRO Services
Product recommended

All CPNE1 Reagents
CPNE1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1614 bp
Description
Full length Clone DNA of Human copine I with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CPNE1 cDNA ORF Clone, Human, N-His tag Alternative Names
COPN1 cDNA ORF Clone, Human;CPN1 cDNA ORF Clone, Human
CPNE1 Background Information

Copine I, also known as CPN1, is a member of the copine family. Copine I is a calcium-dependent membrane-binding protein which has a wide tissue distribution. Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. Copine I contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus, while it does not contain a predicted signal sequence or transmembrane domains. Copine I may function in membrane trafficking.

Full Name
copine I
References
  • Cowland JB, et al. (2003) Tissue expression of copines and isolation of copines I and III from the cytosol of human neutrophils. J Leukoc Biol. 74(3):379-88.
  • Tomsig JL, et al. (2003) Identification of targets for calcium signaling through the copine family of proteins. Characterization of a coiled-coil copine-binding motif. J Biol Chem. 278 (12):10048-54.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • CPNE1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CPNE1 cDNA ORF Clone in Cloning Vector, Mouse MG5A3300-U
    CPNE1 cDNA ORF Clone, Mouse, untagged MG5A3300-UT
    CPNE1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3300-ACG
    CPNE1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3300-ACGLN
    CPNE1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3300-ANG
    CPNE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3300-ACR
    CPNE1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3300-ANR
    CPNE1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3300-CF
    CPNE1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3300-NF
    CPNE1 cDNA ORF Clone, Mouse, C-His tag MG5A3300-CH
    CPNE1 cDNA ORF Clone, Mouse, N-His tag MG5A3300-NH
    CPNE1 cDNA ORF Clone, Mouse, C-HA tag MG5A3300-CY
    CPNE1 cDNA ORF Clone, Mouse, N-HA tag MG5A3300-NY
    CPNE1 cDNA ORF Clone, Mouse, C-Myc tag MG5A3300-CM
    CPNE1 cDNA ORF Clone, Mouse, N-Myc tag MG5A3300-NM

    CPNE1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CPNE1 cDNA ORF Clone in Cloning Vector, Human HG14283-G
    CPNE1 cDNA ORF Clone, Human, untagged HG14283-UT
    CPNE1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14283-ACG
    CPNE1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14283-ACGLN
    CPNE1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14283-ANG
    CPNE1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14283-ACR
    CPNE1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14283-ANR
    CPNE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14283-CF
    CPNE1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14283-NF
    CPNE1 cDNA ORF Clone, Human, C-His tag HG14283-CH
    CPNE1 cDNA ORF Clone, Human, C-HA tag HG14283-CY
    CPNE1 cDNA ORF Clone, Human, N-HA tag HG14283-NY
    CPNE1 cDNA ORF Clone, Human, C-Myc tag HG14283-CM
    CPNE1 cDNA ORF Clone, Human, N-Myc tag HG14283-NM
    CPNE1 qPCR Primer Pairs, Human HP102933
    info info
    添加购物车成功! 添加购物车失败!