Quick Order

Human CPLX3 / Complexin 3 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CPLX3 cDNA Clone Product Information
NCBI RefSeq:BC018026
RefSeq ORF Size:477bp
cDNA Description:Full length Clone DNA of Homo sapiens complexin 3.
Gene Synonym:CPXIII, CPX-III, Nbla11589
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CPLX3, also known as complexin 3, belongs to the complexin/synaphin family. As a SNARE-binding protein, complexin (CPX), can act either as a facilitator or as an inhibitor of membrane fusion, constituting a controversial dilemma. CPX acts sequentially on assembling SNAREpins, first facilitating zippering by nearly doubling the distance at which v- and t-SNAREs can engage and then clamping them into a half-zippered fusion-incompetent state. Specifically, the central helix of CPX allows SNAREs to form this intermediate energetic state at 9-15 nm but not when the bilayers are closer than 9 nm. Stabilizing the activated-clamped state at separations of less than 9 nm requires the accessory helix of CPX, which prevents membrane-proximal assembly of SNAREpins. CPLX3 binds to the SNARE core complex containing SNAP25, VAMP2 and STX1A.

References
  • Newton-Cheh C. et al., 2009, Nat Genet. 41(6): 666-76.
  • Li F. et al., 2011, Nat Struct Mol Biol. 18 (8): 941-6.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • Size / Price
    Catalog: HG14518-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"