Quick Order

Human Carboxypeptidase B1/CPB1 Gene ORF cDNA clone expression plasmid, C-HA tag

  • other Green fluorescent protein / GFP Gene Plasmid Map 5612
DatasheetReviewsRelated ProductsProtocols
Human CPB1 cDNA Clone Product Information
NCBI RefSeq:NM_021804.1
RefSeq ORF Size:1296 bp
cDNA Description:Full length Clone DNA of Homo sapiens carboxypeptidase B1 (tissue) with C terminal HA tag.
Gene Synonym:PASP, PCPB, DKFZp779K1333
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-CPB1-HA
Restriction Site:KpnI + XbaI(6kb+1.3kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CPB1 qPCR primers for gene expression analysis, HP100522 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Carboxypeptidase B1, also well known as pancreatic procarboxypeptidase B (PCPB), is a highly pancreas -specific protein (PASP), and has been identified previously as a serum marker for acute pancreatitis and pancreatic graft rejection. As the prototype for those human exopeptidases that cleave off basic C-terminal residues, CPB1 specifically cleaves the C-terminal Arg and Lys residues with a preference for Arg. The B1 and B2 forms of procarboxypeptidase B differ from each other mainly in isoelectric point.The deduced amino acid sequence of PCPB predicts a 416-amino acid preproenzyme consisting of a 15-aa signal peptide, a 95-aa activation peptide and a 307-aa mature chain. The secreted PCPB zymogen is converted to enzymatically active CPB1 by limited proteolysis by trypsin.

References
  • Yamamoto, K.K. et al., 1992, J. Biol. Chem. 267: 2575-2581.
  • Pezzilli, R. et al., 1994, Digestion. 55: 73-77.
  • Barbosa Pereira, P.J. et al., 2002, J. Mol. Biol. 321: 537-547.
  • Size / Price
    Catalog: HG10501-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"