Carboxypeptidase A cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10504-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Carboxypeptidase A Reagents
CRO Services
Product recommended

All Carboxypeptidase A Reagents
Carboxypeptidase A cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1260 bp
Description
Full length Clone DNA of Human carboxypeptidase A1 (pancreatic) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carboxypeptidase A cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CPA cDNA ORF Clone, Human
Carboxypeptidase A Background Information

Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

Full Name
carboxypeptidase A1 (pancreatic)
References
  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Carboxypeptidase A cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase A cDNA ORF Clone in Cloning Vector, Cynomolgus CG90550-U
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, untagged CG90550-UT
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90550-ACG
    Carboxypeptidase A Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90550-ACGLN
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90550-ACR
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90550-CF
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90550-NF
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, C-His tag CG90550-CH
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, N-His tag CG90550-NH
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, C-HA tag CG90550-CY
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, N-HA tag CG90550-NY
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, C-Myc tag CG90550-CM
    Carboxypeptidase A cDNA ORF Clone, Cynomolgus, N-Myc tag CG90550-NM

    Carboxypeptidase A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase A cDNA ORF Clone in Cloning Vector, Rat RG80926-U
    Carboxypeptidase A cDNA ORF Clone, Rat, untagged RG80926-UT
    Carboxypeptidase A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80926-ACG
    Carboxypeptidase A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80926-ACGLN
    Carboxypeptidase A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80926-ACR
    Carboxypeptidase A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80926-CF
    Carboxypeptidase A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80926-NF
    Carboxypeptidase A cDNA ORF Clone, Rat, C-His tag RG80926-CH
    Carboxypeptidase A cDNA ORF Clone, Rat, N-His tag RG80926-NH
    Carboxypeptidase A cDNA ORF Clone, Rat, C-HA tag RG80926-CY
    Carboxypeptidase A cDNA ORF Clone, Rat, N-HA tag RG80926-NY
    Carboxypeptidase A cDNA ORF Clone, Rat, C-Myc tag RG80926-CM
    Carboxypeptidase A cDNA ORF Clone, Rat, N-Myc tag RG80926-NM
    Carboxypeptidase A qPCR Primer Pairs, Rat RP300890

    Carboxypeptidase A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase A cDNA ORF Clone in Cloning Vector, Mouse MG50448-M
    Carboxypeptidase A cDNA ORF Clone, Mouse, untagged MG50448-UT
    Carboxypeptidase A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50448-ACGLN
    Carboxypeptidase A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50448-ACG
    Carboxypeptidase A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50448-ACR
    Carboxypeptidase A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50448-CF
    Carboxypeptidase A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50448-NF
    Carboxypeptidase A cDNA ORF Clone, Mouse, C-His tag MG50448-CH
    Carboxypeptidase A cDNA ORF Clone, Mouse, N-His tag MG50448-NH
    Carboxypeptidase A cDNA ORF Clone, Mouse, C-HA tag MG50448-CY
    Carboxypeptidase A cDNA ORF Clone, Mouse, N-HA tag MG50448-NY
    Carboxypeptidase A cDNA ORF Clone, Mouse, C-Myc tag MG50448-CM
    Carboxypeptidase A cDNA ORF Clone, Mouse, N-Myc tag MG50448-NM
    Carboxypeptidase A qPCR Primer Pairs, Mouse MP200457

    Carboxypeptidase A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase A cDNA ORF Clone in Cloning Vector, Human HG10504-M
    Carboxypeptidase A cDNA ORF Clone, Human, untagged HG10504-UT
    Carboxypeptidase A cDNA ORF Clone, Human, C-GFPSpark® tag HG10504-ACG
    Carboxypeptidase A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10504-ACGLN
    Carboxypeptidase A cDNA ORF Clone, Human, C-OFPSpark® tag HG10504-ACR
    Carboxypeptidase A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10504-NF
    Carboxypeptidase A cDNA ORF Clone, Human, C-His tag HG10504-CH
    Carboxypeptidase A cDNA ORF Clone, Human, N-His tag HG10504-NH
    Carboxypeptidase A cDNA ORF Clone, Human, C-HA tag HG10504-CY
    Carboxypeptidase A cDNA ORF Clone, Human, N-HA tag HG10504-NY
    Carboxypeptidase A cDNA ORF Clone, Human, C-Myc tag HG10504-CM
    Carboxypeptidase A cDNA ORF Clone, Human, N-Myc tag HG10504-NM
    Carboxypeptidase A qPCR Primer Pairs, Human HP100525
    info info
    添加购物车成功! 添加购物车失败!