COQ9 cDNA ORF Clone, Human, C-HA tag

Cat: HG15252-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COQ9 Reagents
CRO Services
Product recommended

All COQ9 Reagents
COQ9 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
957 bp
Description
Full length Clone DNA of Human coenzyme Q9 homolog (S. cerevisiae) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COQ9 cDNA ORF Clone, Human, C-HA tag Alternative Names
C16orf49 cDNA ORF Clone, Human;COQ10D5 cDNA ORF Clone, Human
COQ9 Background Information
Full Name
coenzyme Q9

COQ9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COQ9 cDNA ORF Clone in Cloning Vector, Mouse MG51942-G
COQ9 cDNA ORF Clone, Mouse, untagged MG51942-UT
COQ9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51942-ACGLN
COQ9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51942-ACG
COQ9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51942-ANG
COQ9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51942-ACR
COQ9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51942-ANR
COQ9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51942-CF
COQ9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51942-NF
COQ9 cDNA ORF Clone, Mouse, C-His tag MG51942-CH
COQ9 cDNA ORF Clone, Mouse, N-His tag MG51942-NH
COQ9 cDNA ORF Clone, Mouse, C-HA tag MG51942-CY
COQ9 cDNA ORF Clone, Mouse, N-HA tag MG51942-NY
COQ9 cDNA ORF Clone, Mouse, C-Myc tag MG51942-CM
COQ9 cDNA ORF Clone, Mouse, N-Myc tag MG51942-NM
COQ9 qPCR Primer Pairs, Mouse MP201815

COQ9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COQ9 cDNA ORF Clone in Cloning Vector, Human HG15252-G
COQ9 cDNA ORF Clone, Human, untagged HG15252-UT
COQ9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15252-ACGLN
COQ9 cDNA ORF Clone, Human, C-GFPSpark® tag HG15252-ACG
COQ9 cDNA ORF Clone, Human, N-GFPSpark® tag HG15252-ANG
COQ9 cDNA ORF Clone, Human, C-OFPSpark® tag HG15252-ACR
COQ9 cDNA ORF Clone, Human, N-OFPSpark® tag HG15252-ANR
COQ9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15252-CF
COQ9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15252-NF
COQ9 cDNA ORF Clone, Human, C-His tag HG15252-CH
COQ9 cDNA ORF Clone, Human, N-His tag HG15252-NH
COQ9 cDNA ORF Clone, Human, N-HA tag HG15252-NY
COQ9 cDNA ORF Clone, Human, C-Myc tag HG15252-CM
COQ9 cDNA ORF Clone, Human, N-Myc tag HG15252-NM
COQ9 qPCR Primer Pairs, Human HP103878
info info
添加购物车成功! 添加购物车失败!