COQ6 cDNA ORF Clone, Human, N-His tag

Cat: HG11464-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COQ6 Reagents
CRO Services
Product recommended

All COQ6 Reagents
COQ6 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Description
Full length Clone DNA of Human coenzyme Q6 homolog, monooxygenase (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COQ6 cDNA ORF Clone, Human, N-His tag Alternative Names
CGI-10 cDNA ORF Clone, Human;CGI10 cDNA ORF Clone, Human;COQ10D6 cDNA ORF Clone, Human
COQ6 Background Information
Full Name
coenzyme Q6 monooxygenase

COQ6 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
COQ6 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90353-G
COQ6 cDNA ORF Clone, Cynomolgus, untagged CG90353-UT
COQ6 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90353-ACG
COQ6 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90353-ACGLN
COQ6 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90353-ANG
COQ6 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90353-ACR
COQ6 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90353-ANR
COQ6 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90353-CF
COQ6 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90353-NF
COQ6 cDNA ORF Clone, Cynomolgus, C-His tag CG90353-CH
COQ6 cDNA ORF Clone, Cynomolgus, N-His tag CG90353-NH
COQ6 cDNA ORF Clone, Cynomolgus, C-HA tag CG90353-CY
COQ6 cDNA ORF Clone, Cynomolgus, N-HA tag CG90353-NY
COQ6 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90353-CM
COQ6 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90353-NM

COQ6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COQ6 cDNA ORF Clone in Cloning Vector, Mouse MG5A6713-U
COQ6 cDNA ORF Clone, Mouse, untagged MG5A6713-UT
COQ6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6713-ACGLN
COQ6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6713-ACG
COQ6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6713-ACR
COQ6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6713-CF
COQ6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6713-NF
COQ6 cDNA ORF Clone, Mouse, C-His tag MG5A6713-CH
COQ6 cDNA ORF Clone, Mouse, N-His tag MG5A6713-NH
COQ6 cDNA ORF Clone, Mouse, C-HA tag MG5A6713-CY
COQ6 cDNA ORF Clone, Mouse, N-HA tag MG5A6713-NY
COQ6 cDNA ORF Clone, Mouse, C-Myc tag MG5A6713-CM
COQ6 cDNA ORF Clone, Mouse, N-Myc tag MG5A6713-NM

COQ6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COQ6 cDNA ORF Clone in Cloning Vector, Human HG11464-M
COQ6 cDNA ORF Clone, Human, untagged HG11464-UT
COQ6 cDNA ORF Clone, Human, C-GFPSpark® tag HG11464-ACG
COQ6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11464-ACGLN
COQ6 cDNA ORF Clone, Human, C-OFPSpark® tag HG11464-ACR
COQ6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11464-CF
COQ6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11464-NF
COQ6 cDNA ORF Clone, Human, C-His tag HG11464-CH
COQ6 cDNA ORF Clone, Human, C-HA tag HG11464-CY
COQ6 cDNA ORF Clone, Human, N-HA tag HG11464-NY
COQ6 cDNA ORF Clone, Human, C-Myc tag HG11464-CM
COQ6 cDNA ORF Clone, Human, N-Myc tag HG11464-NM
COQ6 qPCR Primer Pairs, Human HP101341
info info
添加购物车成功! 添加购物车失败!